Targeting the vasculature of colorectal carcinoma with a fused protein of(RGD)3-tTF Zheng-jie Huang1*,Yilin Zhao2*,Qi Luo1#
1Department of Surgical Oncology,First Affiliated Hospital of Xiamen University,Xiamen,Fujian Province,China.2Department of hepatobiliary surgery,Zhongshan Hospital of Xiamen University, Xiamen,Fujian Province,China.
Author contribution:Zheng-jie Huang,Yilin Zhao performed the experiments and analyzed the data, Qi Luo designed the research and wrote the manuscript.
This research was performed in Xiamen University University,China.
*authors contributed equally to this research
#Correspondence and Request for Reprints to:
Department of Oncological Surgery,
First Hospital,Xiamen University,Xiamen,China.
361004Xiamen,China
Telefax:
E-mail:luoqixmzsh@126
Abstract
Purpose:Truncated tissue factor(tTF)-fusion protein targeting tumor vasculature can induce tumor vascular thrombosis and necrosis.Here,we generated(RGD)3-tTF in which three Arginine-glycine-aspartic(abbr.RGD)targeting integrinαvβ3and tTF inducing blood coagulation in tumor vessels.
Methods:The bioactivities of(RGD)3-tTF including coagulation activity,FⅩactivation and binding with integrinαvβ3were performed.The fluorescent labeled(RGD)3-tTF was intravenously injected into tumor-bearing mice and traced in vivo.The tumor growth,volume,blood vessel thrombosis,tumor necrosis and survival time of mice treated with(RGD)3-tTF were evaluated.
冰冻切片Results:The clotting time and FⅩactivation of(RGD)3-tTF were similar to that of TF(P>0.05),but different with that of RGD(P<0.05).(RGD)3-tTF presented a higher binding withαvβ3than that of RGD and TF at the concentration of0.2μmol/L(P<0.05).(RGD)3-tTF could specifically assemble in tumor a 制定和制订的
区别nd be effective in reducing tumor growth by selectively inducing tumor blood vessels thrombosis and tumor necrosis which were absent in mice treated with RGD or TF.The survival time of mice treated with(RGD)3-tTF was higher than that of mice treated with TF or RGD(P<0.05). Conclusion:(RGD)3-tTF may be a promising strategy for the treatment of colorectal cancer.
邬跃
Key words:Colorectal cancer;Arginine-glycine-aspartic polypeptide;Tissue factor,Fusion protein; Tumor vasculature
1.Introduction
Traditionally,treatment approaches for cancer therapy have directly focused on destroying cancer cells and tissue.Recently another treatment approach has achieved great attention.Rather than directly targeting the neoplastic cells,this strategy tried to block the tumor’s blood support system by targeting the tumor vasculature[1,2].
It is known that most tumors remain being quiet and fail to grow over a few millimeters in size without angiogenesis[3].Blood supply is a key factor in cancer tissue surviving,progressing and spreading.The therapeutic potential of targeting the tumor vasculature is quite clear and promising[2].Drugs which are capable of specifically targeting tumor blood vessels have been being
developed and explored. Many of these drugs have been for clinical evaluation.The strategies directly targeting the blood vessel can not only be used alone,but also be used in combination with conventional anticancer treatments [4,5].
Tissue factor(TF)is a transmembrane glycoprotein and is the originating factor of blood coagulation cascade[6].The truncated tissue factor(tTF)is the extracellular domain of tissue factor,and is less 100000-fold than tissue factor in activating blood coagulation[7].The complex of tTF and blood coagulation factorⅦ(FⅦ)can not effectively activate coagulation FactorⅩto trigger the blood coagulation because its incomplete structure is unable to bind with cell membrane[[8,9].The fusion protein consisting of the extracellular domain of tissue factor(truncated tissue factor,tTF)and the antibody which can selectively bind to tumor vasculature[9].The molecules which can specifically bind with the markers on endothelium of tumor blood vessels could be used as the carriers of tTF for improving its binding with endothelium cells and enhancing its coagulation capacity[10].The function of tTF in vector-tTF to activate coagulation FⅩwill restore and is capable of inducing tumor vascular thrombosis and leading to tumor necrosis[11,12].Studies indicated that there were some disadvantages of using antibodies of tumor vascular markers as the specific vector of tTF[8].The disadvantages are mainly reflected in the following two aspects,firstly,as the antibody molecule is rel
atively large,it easily exerts steric hindrance which will affect the binding capacity of tTF with factorⅦand factorⅩ, thus the efficiency of inducing tumor vascular thrombosis is reduced[13].Secondly,antibody-tTF fusion protein can theoretically be taken in by the liver,spleen and other reticuloendothelial system,so there is potential risk of causing thrombosis in these organs[8].
Endothelium of blood vessels in colorectal cancer tissues presents an important target for colorectal cancer therapy[14].Vascular targeting requires the identification of target molecules that are present on vascular endothelium at sufficient density in solid tumors but are absent from endothelial cells in normal tissues[15].Such molecules could be used to target the vascular endothelium of the tumor rather than the tumor cells themselves.Promising candidate molecules include anti-vascular endothelial cell adhesion molecule1(VCAM-1)antibody,anti-vascular endothelial growth factor(VEGF) antibody[16,17].As integrinαvβ3is highly expressed by vascular endothelial cells in colorectal cancer tissues,it could be served as a tumor vascular target for molecular therapyof colorectal cancer[18,19].
Studies indicated that repeated RGD sequences had a higher affinity on integrinαvβ3receptors than the single RGD sequence had[20].Thus,in this study we produced the fusion protein(RGD)3-tTF whi
ch was consisted of tTF and triple peptides of RGD as the carrier of tTF for targeting tumor vasculature in the treatment of mice colorectal carcinoma.
广州塔吊倒塌
2.Materials and methods 2.1Primers preparation
忆韦素园君All primers were synthesized by Sangon Biotech(Shanghai)Co.Ltd.Primers for tTF cDNA were 5'-TCTGGCA CTACAAATACTGTGGC-3'(P1,upstream primer);and 5'-TTCTCTGAATTCCCCTTTCTCC-3'(P2,downstream primer).P3was designed according to the literature[8].P3was an overlapping oligonucleotides which was 5'-CATACCATGGGC(TGCGATTGTCGCGG AGA TTGCTTCTGCGGTGGAGGCGGGTCT)3TCTGGCACTACAAATAC-3'(the straight line was RGD-4C sequence,tiny curve line was5’end sequence of tTFgene).Primers containing endonuclease sites of NcoⅠand XhoⅠwere5'-CATACCATGGGCTGCGATTGTC-3'(P4upstream primer)and 5'-CTACCT
CGAGTTCTCTGA ATTCCCCTTTCTCC-3'(P5downstream primer).
2.2Construction of fusion gene of(RGD)3-tTF.
The gene of(RGD)3-tTF was amplified by PCR.Briefly,tTF-pSK(+)was used as the template,P1and P2were used as primers,the tTF gene was amplified by using routine PCR.Then the amplified tTF gene and P3were added into PCR reaction system and annealed to achieve the fusion gene template of (RGD)3-tTF.P4and P5were then added into the PCR reaction system to produce the fusion gene of (RGD)3-tTF containing NcoⅠand XhoⅠendonuclease sites in the5'and3'ends respectively.
2.3Preparation of Vector containing(RGD)3-tTF gene.
By using the DNA Ligation Kit(NEB),the cDNA of(RGD)3-tTF was cloned into the expression vector pET22b(+)(Novagen)containing NcoⅠand XhoⅠendonuclease sites.Briefly,the fusion gene of (RGD)3-tTF and pET22b(+)were digested with the NcoⅠand XhoⅠrestriction enzyme.The (RGD)3-tTF gene was then cloned into pET22b(+)to produce an expression vector encoding a fusion protein.The(RGD)3-tTF-pET22b(+)vector was then transferred li)BL21(DE3)and cultured in ampicillin plate for selective screening.The positive clones were used for(RGD)3-tTF sequencing analysis.
2.4The expression and purification of fusion protein
To amplify li colonies containing the reconstructed vetor of(RGD)3-tTF-pET22b(+).The (RGD)3-tTF fusion protein was expressed in Escherichia coli strain and purified by Nickel-affinity