REGULAR ARTICLE
Plasminogen activator inhibitor-14G/5G polymorphism in breast cancer patients and its association with tissue PAI-1levels and tumor severity
Remedios Castello ´a ,Francisco Espan ˜a a ,Carlos Va ´zquez b ,Carlos Fuster b ,
Sergio M.Almenar b ,Justo Aznar a ,Amparo Estelle
´s a ,*a
Hospital Universitario La Fe,Centro de Investigacio ´n.Avda.Campanar 21,46009Valencia,Spain
b
Instituto Valenciano de Oncologı´a,Valencia,Spain
Received 21February 2005;received in revised form 21March 2005;accepted 22March 2005Available online 23May 2005
Abstract
Background:The plasminogen activator inhibitor type 1(PAI-1)4G/5G polymorphism may have significance for PAI-1expression.High levels of PAI-1in breast cancer patients are associated with a poor prognosis.In this study,we analyzed the influence of the PAI-14G/5G polymorphism on tissue PAI-1levels and its association with tumor severity in women with breast cancer.
Material and methods:We studied 104women with breast carcinoma (patient group)and 104healthy age-matched women (control group).In patients and controls,the PAI-14G/5G polymorphism was determined by PCR amplification using allele-specific primers.In patients,PAI-1levels were quantified in breast cancer tissue by using an ELISA.
Results:The frequency of the PAI-14G allele tended to be higher in patients than in controls (p =0.062).The presence of the 4G allele (4G/5G plus 4G/4G genotypes)was significantly higher among patients with histological grade 3tumors than among those with grade 1tumors (p =0.026).Furthermore,patients with the 4G/4G genotype had significantly higher tissue PAI-1levels than those with the 5G/5G genotype.Moreover ,tissue PAI-1antigen levels were significantly and positively correlated with tumor severity (p =0.003)and tumor size (p =0.009).However ,no
0049-3848/$-see front matter D 2005Elsevier Ltd.All rights reserved.doi:10.1016/j.thromres.2005.03.025
Abbreviations:PAI-1,Plasminogen activator inhibitor type 1;uPA,urokinase type plasminogen activator;tPA,tissue type plasminogen activator .
*Corresponding author .Tel.:+34963862797;fax:+34961973018.E-mail address:estelles _amp@gva.es (A.Estelle ´s).KEYWORDS
Breast cancer;PAI-1gene polymorphism;PAI-1;
Fibrinolysis
Thrombosis Research (2006)117,487—
492
intl.elsevierhealth/journals/thre
significant differences in PAI-1level were observed in relation to menopause, hormone receptor or nodal status.
Conclusion:Tissue PAI-1antigen levels and tumor severity seem to be associated with the PAI-14G/5G polymorphism.Further studies with a larger number of patients are needed to clarify the influence of this polymorphism in breast cancer.
D2005Elsevier Ltd.All rights reserved.
Introduction
T umor cell invasion and metastasis result from interactions between cell migration potential,cell adhesion properties,and extracellular matrix pro-teolysis[1].Urokinase type plasminogen activator (uPA)is a serine protease that catalyzes the conversion of plasminogen to plasmin,an active enzyme that can degrade a variety of extracellular matrix proteins[1].It is generally believed that uPA initiates a proteolytic cascade on the cell surface,which promotes tumor invasion and an-giogenesis[2].uPA is
inhibited mainly by plasmin-ogen activator inhibitor type1(PAI-1),but can also be inhibited by PAI-2and PAI-3.All PAIs are members of the superfamily of serine protease inhibitors[3—7].
PAI-1,the primary inhibitor of the plasminogen activation system,inactivates tissue type plasmin-ogen activator(tPA)and uPA[3]but also plays an important role in signal transduction,cell adher-ence,and migration.Indeed,studies of several types of cancers,including breast cancer,have paradoxically shown that increased uPA and PAI-1 levels are associated with aggressive tumor behav-ior and poor prognosis[8—10].One might speculate that,since uPA promotes invasion and metastasis, increase in tumor tissue PAI-1levels should produce a reduction in the local invasion and development of metastasis.However,several studies have shown,on the contrary,that PAI-1actually pro-motes those aggressive behaviors[11—14].Possible mechanisms by which PAI-1contributes to cancer dissemination include prevention of excessive deg-radation of the extracellular matrix,modulation of cell adhesion[15,16],and stimulation of angiogen-esis[17—19]and cell proliferation[20].
In vitro studies have shown that PAI-1levels can be altered by cytokines,growth factors,and hormones[21,22],but the genetic and environ-mental determinants of PAI-1expression are not fully understood.Changes in PAI-1biosynthesis are usually preceded by changes in its gene transcrip-tion[23—25].A guanosine insertion/deletion poly-morphism in the promoter region of the PAI-1gene a
t theÀ675bp position,named4G/5G,has been described[26].In vitro studies suggest that the4G allele has higher activity than the5G allele because the5G allele contains an additional binding site for a DNA-binding protein that acts as a transcriptional repressor[27,28].Studies involving healthy subjects or patients with coro-nary artery disease or metabolic syndrome have reported that high plasma levels of PAI-1are associated with a high prevalence of the4G allele [27—30].
Results of studies on the association between the PAI-14G/5G polymorphism and the invasive behav-ior of cancer are contradictory.Although one study reported that there was no association between the polymorphism and cancer progression[25],another suggested that the5G/5G genotype is associated with less aggressive cancer phenotypes[32].
In this study,we examined the influence of the PAI-14G/5G polymorphism on tissue PAI-1levels and its association with tumor severity in women with breast cancer.
Materials and methods
Clinical groups
One hundred and four patients(mean age60years; range24—83years)with primary,operable,and unilateral breast cancer were included in our study.
Patients with distant metastasis or other malig-nancies at the time of diagnosis were excluded from the study,as were those that had been treated prior to surgery(neoadjuvant therapy)or had presented with synchronous bilateral breast cancer.
Age,menopausal status,tumor size and histo-logical characteristics,axillary lymph node infiltra-tion,and steroid receptor status of patients were recorded(Table1).T umor severity was scored according to the Scarf—Bloom—Richardson criteria (SBR histological grade)[33,34].
All cancer patients underwent surgery.Samples of tumor tissue were taken for protein analysis and DNA extraction,and were snap frozen in liquid nitrogen immediately after excision.
The control group was recruited from same geographical area as the patients and comprised
R.Castello´et al.
488
104unrelated age-matched women(mean age58 years;range24—85years).All the controls appeared to be healthy and those older than50 years had undergone a clinical and mammographic examination every two years since the age of50. All participants in the study gave informed consent
before inclusion.The protocol was approved by the local ethics committee.
Methods
PAI-1promoter4G/5G polymorphism
DNA was extracted from whole blood collected into tubes containing EDTA(controls)or from breast tissue samples(patients)using the Genomic Purifi-cation System(Promega,Madison,WI)and follow-ing the manufacturer’s protocol.The PAI-1 promoter4G/5G polymorphism was analyzed using an allele-specific PCR technique modified from Falk et al.[35]as described previously[28].An alter-native forward primer[GTCTGGACACGTGGGGG for the5G allele or GTCTGGACACGTGGGGA for the4G allele]with a common reverse primer[GCTGTCCA-CCCGGTGCTCTG](designed to minimize dimer-primer formation)and a control reverse upstream primer[AAGCTTTTACCATGGTAACCCCTGGT]were used.The PCR procedure included an initial hot-start step to avoid the production of dimer-primer artifacts.Electrophoresis was performed using3%high-resolution agarose MS-8(Pronadisa, Condalab,Madrid,Spain).Photographs of gels were taken after ethidium bromide staining. Quantification of PAI-1antigen and total protein For PAI-1antigen determination,frozen samples of tumor tissue were homogenized in10mmol/L Tris—HCl buf
fer,pH7.4,containing1.5mmol/L EDTA and 10%glycerol.The suspension was centrifuged at 100,000Âg at48C for15min,and aliquots of the supernatant(cytosol extract)were stored atÀ80 8C.The pelleted membranes were solubilized in20 mmol/L Tris—HCl buffer containing125mM NaCl and1%Triton X-100,incubated overnight at48C, and centrifuged at100,000Âg at48C for15min. Aliquots of the supernatant(membrane extract) were stored atÀ808C.
PAI-1antigen in cytosol and membrane extracts from breast cancer tissue was quantified using an ELISA(Tint Elize PAI-1,Biopool,Sweden).The assay detects active and latent(inactive)forms of PAI-1 and complexed PAI-1with equal efficiency.The intra-and interassay variabilities were3%and7%, respectively.
Total protein concentration in cytosol and mem-brane extracts was determined using the BCA protein assay(Pierce,Rockford,IL).Fraction V bovine serum albumin(Sigma-Aldrich,St Louis,MO) was used for calibration.Samples and standards were analyzed in duplicate.
Estrogen and progesterone receptors
Estrogen and progesterone receptors were assayed by ELISA(ER-EIA Monoclonal and PgR-EIA Monoclo-nal,respectively,Abbott Laboratories,Chicago, IL).The cutoff point was set at15fmol/mg cyto
solic protein.
Statistical analysis
The Chi-squared test was used to detect differ-ences in allele and genotype frequencies between patients and controls and according to tumor severity in patients.The Kruskal—Wallis test was used to compare differences in PAI-1levels be-tween genotypes and tumor severity groups.Dif-ferences in PAI-1levels between menopausal status,hormone receptor status,tumor size,and nodal status groups were determined using the Mann—Whitney test.Values of p b0.05were con-sidered to be statistically significant.All data were
Table1Clinical characteristics of breast cancer
patients
Parameter Number of patients
Menopausal status104
Pre/perimenoupausal31
Postmenopausal73
Estrogen receptor a
Positive84
Negative20
Progesterone receptor a
Positive71
Negative33
龙摄天下摄影团
Tumor size
T1(V2cm)55
T2(N2cm)49
Nodal status
N056
N148
SBR b histological grade
145
242
317
Histological features
Invasive ductal carcinoma88
Invasive lobular carcinoma7
Other types c9
a Cutoff point=15fmol/mg protein.
b SBR:Scarf—Bloom—Richardson.
ttpc Include tubular,cribiform,glucogen-rich an
d papillary
carcinoma.
PAI-14G/5G and breast cancer489
analyzed with the statistical package,SPSS Release 10.0for Windows (SPSS Inc.,Chicago,IL).
Results
To determine whether the PAI-14G/5G polymor-phism contributes to the level of PAI-1antigen in breast cancer tissue,we genotyped 104women with breast cancer and 104age-matched control women.The PAI-14G allele frequency tended to be higher in patients (0.55)than in controls (0.45)(p =0.062).
The presence of the 4G allele (4G/5G plus 4G/4G genotypes)was significantly higher in the group of
patients with histological grade 3tumors than in the group with grade 1tumors (p =0.026).It was also higher in the group with grade 2tumors than in the group with grade 1tumors (p =0.040)(Table 2).Patients with the 4G allele (4G/5G plus 4G/4G genotypes)constituted a significantly higher per-centage of those with a tumor size N 2cm (T 2)than of those with a tumor size V 2cm (T 1)(96%and 78%,respectively)(p =0.009).However ,no significant differences in the distribution of the 4G/5G geno-type were observed in relation to the presence of hormone receptors and nodal status (data not shown).
We determined whether the PAI-14G/5G poly-morphism modulates tissue PAI-1levels (Table 3).We found that tissue antigen PAI-1levels increased with the number of 4G alleles (p =0.008).Similarly,we compared tissue PAI-1levels among three groups of tumor classed according to SBR (Table 3).We
found that tissue PAI-1levels increased as the histological tumor grade worsened (p =0.003).
Tissue PAI-1levels were higher in the 49patients with a tumor size N 2cm (T 2)than in the 55patients with a tumor size V 2cm (T 1)(mean,median,range:4.30,3.9,0.30—11.63ng/mg vs.3.02,3.1,0—10.37ng/mg,respectively;p =0.009).However ,no significant differences in PAI-1level were observed in relation to menopause,hormone re-ceptor or nodal status.
关于依法严惩
危害食品安全犯罪活动的通知
Discussion
In the present study,we found that tissue PAI-1levels and the frequency of the PAI-14G allele were significantly increased in patients with less favor-able tumor characteristics (histological grade and macroscopic size).Furthermore,patients with the 4G/4G genotype had tissue PAI-1levels significantly higher than those with the 5G/5G genotype.
Several studies have shown that high tissue levels of PAI-1,u-PA and uPA:PAI-1complex are associated with a poor prognosis in breast cancer [8—14,36,37].Moreover ,there is increasing evi-dence to support a role for PAI-1in the growth,invasion,and metastasis of malignant tumors [38,39].PAI-1could exert these effects by regulat-ing the pericellular function of the plasminogen activator system during migration or by protecting the extracellular matrix,which is necessary for cancer cells during migration.Indeed,higher tissue PAI-1expression has been associated with aggres-sive tumors [38].
Table 2
4G/5G PAI-1polymorphism and allelic frequency by histological tumor grade (tumor severity)in patients
Grade 1(n =45)Grade 2(n =42)Grade 3(n =17)n
Frequency n Frequency n Frequency Allele 5G 470.52
350.42120.354G
43
0.48
49
0.58
22
0.65
Genotype a 5G/5G
110.2430.07004G/4G or 4G/5G (presence of 4G allele)
340.76390.9317 1.00
a
Statistical significance (p =0.013).ade 1(p =0.026);ade 1(p =0.040).
Table 3
Tissue PAI-1levels according to 4G/5G PAI-1polymorphism and histological tumor grade in breast cancer
5G/5G (n =14)
4G/5G (n =66)4G/4G (n =24)Statistical significance PAI-1ag (ng/mg)
2.14;1.95(0.75-4.37)
3.72;3.32(0-10.77)
4.21;4.00(0.73-11.63)p =0.008
Grade 1(n=45)
Grade 2(n=42)Grade 3(n=17)Statistical significance PAI-1ag (ng/mg) 2.93;2.90(0-8.8)
3.89;3.71(0.18-11.63)
4.78;4.50(2.2-10.14)
p =0.003
Data are expressed as mean;median and range (ng target protein /mg total protein).
R.Castello ´et al.
490
As the presence of the4G allele results in a higher PAI-1transcription response to cytokines or growth factors than the5G allele[27,39],the4G/ 5G polymorphism may influence tissue PAI-1levels in breast cancer patients through the action of cytokines released by tumor cells.
The4G allele of the PAI-14G/5G polymorphism seems to be associated with increased plasma PAI-1 levels in vascular disease,but little is known about the possible role of the4G/5G polymorphism in ca
ncer.It has been reported that this polymorphism seems to be associated with different rates of uPA:PAI-1complex accumulation in breast cancer and that patients with the5G/5G genotype showed less aggressive tumor behavior[32].However,a lack of association between this PAI-1polymorphism and cancer progression has been observed[31].
功能减退In agreement with a previous study[31],we found no significant differences in allele frequen-cies between patients with breast cancer and controls.On the other hand,both tissue PAI-1 levels and the PAI-14G/5G polymorphism seem to be associated with tumor severity in women with breast cancer.This assertion is based on the observation that tissue PAI-1levels and the number of4G alleles were significantly higher in patients with histological grade3tumors than in those with grade1tumors.The PAI-14G/5G polymorphism was associated with tumor tissue PAI-1levels.Thus,the tissue PAI-1levels significantly increased with the number of4G alleles.As high tissue PAI-1levels seem to be correlated with a poor outcome in women with breast cancer[9—12],our results suggest that certain genetic characteristics,par-ticularly the presence of4G allele,may exert an unfavorable influence on the local behavior of tumors.However,the low number of patients included in our study does not permit to draw definitive conclusions regarding the association of PAI-1polymorphism with breast cancer.
In conclusion,higher frequencies of the4G allele are associated with less favorable local character-istics of breast cancer and with increased levels of tumor tissue PAI-1.Further studies with a greater number of patients are needed to clarify the role of the PAI-14G/5G polymorphism in breast cancer. Acknowledgments
The study was supported by research grants from EVES(02/016)and from Fondo de Investigacio´n Sanitaria,Spain(99/1035,PI020125and PI020136). R.Castello´was recipient of a fellowship(FPI00-05-281)from Consellerı´a de Cultura,Educacio´n y Ciencia,Valencia,Spain.The authors thank Ms Consuelo Morello´,Ms Rosa Valero and Ms Pilar Escamilla for their technical assistance. References
[1]Andreasen PA,Kjoller L,Christensen L,Duffy MJ.The
urokinase-type plasminogen activator system in cancer metastasis:a review.Int J Cancer1997;72:1–22.
[2]Rabbani SA,Mazar AP.The role of the plasminogen
activation system in angiogenesis and metastasis.Surg Oncol Clin N Am2001;10:393–415.
[3]Loskutoff DJ,van Mourik JA,Erickson LA,Lawrence D.
Detection of an unusually stable fibrinolytic inhibitor produced by bovine endothelial cells.Proc Natl Acad Sci U S A1983;80:2956–60.
[4]Ny T,Sawdey M,Lawrence D,Millan JL,Loskutoff DJ.
Cloning and sequence of a cDNA coding for the human beta-migrating endothelial-cell-type plasminogen activator in-hibitor.Proc Natl Acad Sci U S A1986;83:6776–80.
瓶颈工序[5]Ginsburg D,Zeheb R,Yang AY,Rafferty UM,Andreasen PA, Nielsen L,et al.cDNA cloning of human plasminogen activator-inhibitor from endothelial cells.J Clin Invest 1986;78:1673–80.
[6]Suzuki K,Deyashiki Y,Nishioka J,Kurachi K,Akira M,
Yamamoto S,et al.Characterization of a cDNA for human protein C inhibitor.A new member of the plasma serine protease inhibitor superfamily.J Biol Chem1987;262:611–6.
[7]Silverman GA,Bird PI,Carrell RW,Church FC,Coughlin PB,
Gettins PG,et al.The serpins are an expanding superfamily of structurally similar but functionally diverse proteins.
Evolution,mechanism of inhibition,novel functions,and a revised nomenclature.J Biol Chem2001;276:33293–6. [8]Schmitt M,Goretzki L,Janicke F,Calvete J,Eulitz M,
Kobayashi H,et al.Biological and clinical relevance of the urokinase-type plasminogen activator(uPA)in breast can-cer.Biomed Biochim Acta1991;50:731–41.
[9]Harbeck N,Kates RE,Gauger K,Willems A,Kiechle M,
Magdolen V,et al.Urokinase-type plasminogen activator (uPA)and its inhibitor PAI-I:novel tumor-derived factors with a high prognostic and predictive impact in breast cancer.Thromb Haemost2004;91:450–6.
[10]Harbeck N,Kates RE,Schmitt M,Gauger K,Kiechle M,
Janicke F,et al.Urokinase-type plasminogen activator and its inhibitor type1predict disease outcome and therapy response in primary breast cancer.Clin Breast Cancer 2004;5:348–52.
[11]Knoop A,Andreasen PA,Andersen JA,Hansen S,Laenkholm
AC,Simonsen AC,et al.Prognostic significance of uroki-nase-type plasminogen activator and plasminogen activator inhibitor-1in primary breast cancer.Br J Cancer1998;77: 932–40.
[12]Foekens JA,Peters HA,Look MP,Portengen H,Schmitt M,
Kramer MD,et al.The urokinase system of plasminogen activation and prognosis in2780breast cancer patients.
Cancer Res2000;60:636–43.
[13]Sumiyoshi K,Baba S,Sakaguchi S,Urano T,Takada Y,Takada
A.Increase in levels of plasminogen activator and type-1
plasminogen activator inhibitor in human breast cancer: possible roles in tumor progression and metastasis.Thromb Res1991;63:59–71.
[14]Castello R,Estelles A,Vazquez C,Falco C,Espan˜a F,
Almenar SM,et al.Quantitative real-time reverse tran-scription-PCR assay for urokinase plasminogen activator,
PAI-14G/5G and breast cancer491
豫公网安备41160202000603
站长QQ:729038198
关于我们
投诉建议