The Jun Kinase/Stress-activated Protein Kinase Pathway Functions to Regulate DNA Repair and Inhibition of the Pathway Sensitizes Tumor Cells to Cisplatin*
(Received for publication,January6,1997,and in revised form,
April1,1997) Olga Potapova,Ali Haghighi,Fre´de´ric Bost,
Chaoting Liu,Michael J.Birrer‡,Ruth Gjerset,
and Dan Mercola§¶
From the Sidney Kimmel Cancer Center,San Diego,
California92121,the§Center for Molecular Genetics,
University of California at San Diego,La Jolla,
California92093,and the‡Division of Biomarkers and
Prevention Research Branch,National Institutes of
Health,Rockville,Maryland20850
We have studied the role of Jun/stress-activated pro-tein kinase(JNK/SAPK)pathway in DNA repair and cisplatin resistance in T98G glioblastoma cells.JUN/ SAPK is activated by DNA damage and phosphorylates serines63and73in the N-terminal domain of c-Jun, which is known to increase its transactivation proper-ties.We show that treatment of T98G glioblastoma cells with cisplatin but not the transplatin isomer activates JNK/SAPK about10-fold.T98G cells,which are highly
resistent to cisplatin(IC
加权最小二乘法50؍140؎13M),modified to express a nonphosphorylatable dominant negative c-Jun(termed dnJun)exhibit decreased viability follow-ing treatment with cisplatin,but not transplatin,in pro-
portion(r
Pearson ؍0.98)to the level of dnJun expressed
leading to a7-fold decreased IC
50.Similar effects are
肌球蛋白
observed in U87cells,PC-3cells,and MCF-7cells,as well as in T98G cells modified to express TAM-67,a known inhibitor of c-Jun function.In contrast,no sensitization effect was observed in cells modified to express wild-type c-Jun.Furthermore,through quantitative polym-erase chain reaction-stop assays,we show that dnJun expressing cells were inhibited in repair of cisplatin adducts(p؍0.55),whereas repair is readily detectable (p؍0.003)in parental cells.These observations indicate that the JNK/SAPK pathway is activated by cisplatin-induced DNA damage and that this response is required for DNA repair and viability following cisplatin treat-ment.Regulation of DNA repair following genotoxic stress may be a normal physiological role of the JNK/ SAPK pathway.
JNK/SAPK1is part of a kinase cascade that phosphorylates the transcription factor c-Jun at serine residues63and73 (1–9).Phosphorylation of c-Jun at these sites greatly enhances the transactivation potential of the AP-1binding sites(1–4) and AP-1regulated genes in vivo(5,11,12),and there is evidence suggesting roles for c-Jun phosphorylation in cellular transformation(1,2),inflammation(14),and apoptosis(15). The JNK/SAPK pathway is strongly stimulated in a dose-de-pendent manner by various DNA damaging treatments,includ-ing UV-C(5,7–8),ionizing radiation(16),and alkylating agents such as N-methyl-NЈ-nitro-N-nitrosoguanidine(MNNG) (5),methylmethanesulfonate(MMS)(11),1--D-arabinofurano-sylcytosine(Ara-C)(17),and hydrogen p
eroxide(18).These observations suggest that the JNK/SAPK pathway may medi-ate a physiological response to DNA damage such as induction of one or more DNA repair enzymes.Here we provide evidence that the chemotherapeutic agent cisplatin,which damages DNA through the formation of bifunctional platinum adducts, but not transplatin,which does not damage DNA(19,20), activates JNK/SAPK up to10-fold in a dose-dependent manner. Furthermore,inhibition of this pathway in cells modified by expression of a nonphosphorylatable dominant negative mu-tant of c-Jun,dnJun,blocks DNA repair as judged by quanti-tative PCR and markedly decreases viability following treat-ment with cisplatin but not transplatin.Thus,JNK/SAPK is activated by cisplatin-induced DNA damage and is required for DNA repair and survival following cisplatin treatment.
EXPERIMENTAL PROCEDURES
Cells—Culture conditions and all cell lines and plasmids used here were developed using standard methods as described previously(22, 23).The expression of c-Jun and dnJun was quantitated using the methods(24)and antibodies previously characterized(24).
PCR—The PCR-stop assay(28)was used to quantitate cisplatin-DNA adduct formation and subsequent repair.The assay is based on the observation that the efficiency of amplification of cispla
tin-treated DNA is inversely proportional to the degree of platination.Genomic DNA was isolated immediately or6h after treatment of cells for1h15 min with varying amounts of cisplatin and amplified quantitatively using32P-end-labeled primers,giving rise to a2.7-kb and a nested 0.15-kb fragment of the hyopxanthine phosphoribosyl transferase gene. The5Јand3Јprimers were TGGGATTACACGTGTGAACCAACC and GATCCACAGTCTGCCTGAGTCACT,respectively,with a5Јnested primer of CCTAGAAAGCACATGGAGAGCTAG.The0.15-kb segment of genomic DNA sustains undetectable levels of DNA damage under our conditions and serves as an internal PCR control and the basis for normalization of the amount of amplification of the2.7-kb fragment. The number of lesions/2.7-kb Fig.4)is calculated as1Ϫ(cpm damaged DNA/cpm undamaged DNA)(8).
JNK Assay—JNK assays were carried out exactly as described pre-viously(7).
Cytotoxicity—Viability(29)was assessed by the addition of cisplatin or transplatin for1h one day after seeding test cells into96-well plates followed by a change of medium to fresh medium and determination of surviving cells5days later by addition of MTS for1h and determina-tion of A
590nm
of the dissolved formazan product as described by the
*This work was supported by Grant CA63783from the National Cancer Institute(to D.A.M.),by La Ligue Nationale Contre le Cancer (to F.B.and D.A.M.),by the Tobacco-Related Diseases Research Program of California(to R.G.),by the U.S.Army Breast Cancer
Research Project(to R.G.),by Introgen Therapeutics,Inc.(to R.G.), and by the Fellowship Program of the Sidney Kimmel Cancer Center. The costs of publication of this article were defrayed in part by the payment of page charges.This article must therefore be hereby marked “advertisement”in accordance with18U.S.C.Section1734solely to indicate this fact.
¶To whom correspondence should be addressed:Sidney Kimmel Can-cer Center,3099Science Park Rd.,San Diego,CA92121.Tel.:619-450-5990;Fax:619-450-3251;E-mail:74361.2163@compuserve.
1The abbreviations used are:JNK,c-Jun N-terminal kinase;AP-1, activator protein complex1;cisplatin,cis-diaminodichloroplatinum; SAPK,stress-activated protein kinase;MTT,micro-tetrazolium(dye) test;transplatin,trans-diaminodichloroplatinum;UV-C,ultraviolet light C band,254nm maximum intensity for UV cross-linker1800; dnJUN,dominant negative c-Jun;PCR,polymerase chain
reaction;kb, kilobase pair;ATF,activation transcription factor;CREB,cAMP re-sponse element binding protein;MTS,(3-(4,5Ј-dimethylthiazol-2-yl)-5-(3-carboxymethoxylphenyl-2-(4-sulfophenyl)-2H-tetrazolium inner salt.
Communication T HE J OURNAL OF B IOLOGICAL C HEMISTRY
分频器
设计Vol.272,No.22,Issue of May30,pp.14041–14044,1997Printed in U.S.A.
This paper is available on line at www-jbc.stanford.edu/jbc/14041 at TSINGHUA UNIVERSITY, on December 8, Downloaded from
manufacturer (Promega).All results were carried out in quadruplicate,and viability is expressed as the ratio of the amount of viable cells following cisplatin or transplatin treatment to that of the same cells without treatment.
RESULTS
Activation of JNK/SAPK by Cisplatin Requires DNA Adduct Formation—It is known that cisplatin but
not transplatin forms covalent covalent cross-links between the N 7position of adjacent guanine or adjacent adenine-guanine residues (19,20).We find that the JNK activity of T98G cells is elevated in a dose-dependent manner up to 10-fold following a 1-h expo-sure to cisplatin but not to transplatin (Fig.1A ).As a positive control of the effects of a DNA-damaging agent,we examined the response of JNK of T98G cells to UV-C irradiation (Fig.1B )and observed a similar dose-response relationship.Cisplatin-specific responses have been observed in other cell lines from tumor types that are commonly refractory to cisplatin treat-ment such as the human nonsmall cell lung carcinoma lines A549(data not shown)and M103(Fig.1C ).Moreover,1h after treatment with cisplatin,but not transplatin,JNK activity of T98G cells or lung carcinoma cells M103remains elevated,suggesting that treatment with cisplatin leads to a prolonged response.These results indicate that only the DNA-damaging cisplatin isomer activates JNK activity.
Dominant Negative c-Jun Sensitizes Tumor Cells to Cisplatin but Not Transplatin—We developed clonal lines of human T98G glioblastoma cells,which stably express a dominant neg-ative inhibitor (1,2)of the JNK/SAPK pathway,dnJun.Ex-pression of dnJun has no effect on either basal AP-1activity (1,2)or on the enzyme activity of JNK (data not shown)but does inhibit phosphorylation-dependent activation of transcription (1,2,10,12).The effect of cisplatin treatment on the viability of re
presentative clonal lines of the dnJun-expressing T98G cells is compared with that of an empty vector control line,T98GLHCX,in Fig.2A .The viability of empty vector control T98G cells remains largely unaffected by treatment with in-creasing concentrations of cisplatin even at doses of Ն70M .Extended titrations revealed IC 50values of 147and 154M for the parental cells and empty vector control cells,respectively (Table I).In contrast,the dnJun expressing cells exhibit an IC 50as low as 21M (Fig.2A )or over 7-fold more sensitive to cisplatin than the control cells (Table I).Replicate experiments using additional clones that exhibit varying amounts of steady state dnJun indicate the sensitization to cisplatin is propor-tional (r Pearson ϭ0.98)to the amount of dnJun expressed (Fig.2B ).Transplatin has no discernible effect at concentrations where the viability following treatment with cisplatin is less than 25%(Fig.3B )and in extended titrations no significant effect at 250M ,indicating that the requirements for sensiti-zation by dnJun depends upon the stereospecific DNA-binding properties of cisplatin,similar to the conditions for the activa-tion of JNK.
Expression of wild-type c-Jun does not mimic dnJun-express-ing cells (Fig.2A ).In fact,the viability of these cells when treated with cisplatin is somewhat increased relative to paren-tal or empty vector control cells for all viability determinations in the range 20–60M cisplatin,suggesting that increased JNK substrate augmented viability following treatment with cisplatin (Fig.2A ).Thus,the sensitization t
o cisplatin observed for the dnJun-expressing cells appears to correlate with inter-ference in the role of activated c-Jun.
Generality—We have tested the generality of the sensitizing properties of dnJun in PC3prostate carcinoma cells modified to express dnJun under the control of an inducible truncated metallothionein promoter as described previously (21).Viabil-ity studies show that parental or empty vector control cells are largely insensitive to cisplatin at concentrations Յ60M (Fig.3A ,circles ).Extended titrations revealed IC 50values of 109and 156M for the parental and empty vector control cells,respec-tively (Table I).However,for PC3cells that stably express pMTdnJun,the IC 50value is markedly reduced (Fig.3A ,open diamonds ).Further,induction of maximum expression of dnJun by the addition of zinc acetate leads to greatly increased cytotoxicity with an IC 50of 16M (Fig.3B )or 7.24–9.8-fold more sensitive to cisplatin than control cells (Table I).The addition of zinc acetate alone has no effect on the viability of parental or empty vector control cells (Fig.3A ,filled circles ).Thus,the results observed following induction of expression of dnJun by a single clonal line confirm the results of Fig.2B that sensitization to cisplatin is dependent upon the expression of dnJun.
As a further control,we examined PC3prostate carcinoma cells modified to express a zinc-inducible c-
Jun derivative,TAM-67,a well characterized transdominant negative
inhibi-
F I
G .2.dnJun sensitizes T98G cells to cisplatin.A ,viability assay of empty vector control cells (q ),wild-t
ype c-Jun expressing cells (f ),and clonal dnJun-expressing cells (ࡗ).B ,dose-response curve of the IC 50
cisplatin of dnJun-expressing clones of T98G cells versus total immu-noreactive c-Jun (c-Jun ϩdnJun ).Total immunoreactive Jun (c-Jun ϩdnJun )was determined by sequential immunoprecipitation of 35S-la-beled cells using specific Jun B,Jun D,followed by pan-Jun antiserum as described previously (24).Values above 8.5are taken as expression of
dnJun.
F I
G .1.Cisplatin is a stereo-specific activator of JNK.A ,T98G human glioblastoma cells were stored overnight in serum-free medium,plated the next day,and treated by the indicated concentrations of cisplatin or transplatin for 1h with a 1-h chase period followed by lysis and assay for JNK activity as described (7).Matching wells of cells were harvested and counted (Coulter counter)and used as the basis for sample loading.FBS ,fetal bovine serum.B ,positive control.T98G cells were exposed to the indicated doses of UV-C band (Stratalinker UV cross-linker 1800)radiation and processed as described for A .C ,JNK activity of human lung carcinoma M103cells following treatment with 200M cisplatin or transplatin and processing as described for A with the addition of a 1-h chase prior to lysis.Inhibition of JNK/SAPK Sensitizes Tumor Cells to Cisplatin
14042 at TSINGHUA UNIVERSITY, on December 8, 2011
Downloaded from
tor of AP-1owing to a deletion of residues 2–122(21).As with dnJun,induction of TAM-67in PC3cells strongly enhances their sensitivity to cisplatin (Fig.3A ).We have determined that these TAM-67and dnJun are expressed in approximately equal amounts,suggesting that the comparable degree of sensitiza-tion for TAM-67and dnJun (Fig.3A )is accounted for by inter-ference in the role of phosphor
ylation-related function of c-Jun.Similar results have been observed with an additional hu-man glioblastoma line,U87,and an additional epithelial tumor line,MCF-7(Table I).Clonal dnJun-expressing lines of these cells exhibit 2.6-and 3.8-fold decreased IC 50values,respec-tively (Table I).Thus,the sum of results indicate that the JNK/SAPK pathway may have a general role in mediating a functional response to DNA-cisplatin adduct formation.Inhibi-tion of this response sensitizes cells to the cell-killing proper-ties of cisplatin.
Cisplatin Activates and dnJun Inhibits DNA Repair—We assessed the extent of genomic DNA damage and repair follow-ing cisplatin treatment using a modified PCR assay (25).For this assay,it has been shown that the degree of inhibition of PCR-catalyzed amplification of DNA purified from cisplatin-treated cells is a direct measure of the amount of DNA-cisplatin adduct formation as measured by atomic absorption (25).Thus,this assay provides a direct assessment of the extent of cispla-tin-induced DNA damage.
DNA isolated from T98G cells immediately after treatment with 0,100,or 200M cisplatin for 1h exhibit increasing levels of DNA damage (Fig.4A ,circles ).However,if a 6-h “recovery”
period is introduced prior to the DNA purification,damage is markedly and significantly (p ϭ0.003)red
uced (Fig.4A ,filled circles ).As a positive control for the effects of inhibition of genomic DNA repair,an inhibitor of ADP-ribosylation,2-ami-nobenzidine,was added at the time of treatment of the cells with cisplatin (Fig.4A ,squares ).Following the 6-h recovery period,DNA damage remained unrepaired,and total DNA damage was substantially increased.Next,we compared the level of DNA damage for T98G cells and dnJun-expressing cells following treatment with cisplatin (Fig.4B ).For the dnJun-expressing T98G cells,6h after cisplatin treatment DNA dam-age remains completely unrepaired for cells treated at either 100or 200M cisplatin (p Ͼ0.53).All the results summarized here (Fig.4,A and B )are the averages of three independent assays,which confirms the reliability of this observation.The sum of results,therefore,strongly indicates that expression of dnJun by T98G cells largely abolishes DNA repair following exposure of the cells to cisplatin.
DISCUSSION
These studies show that the JNK/SAPK pathway is activated by cisplatin-induced DNA damage and is required for DNA repair and viability following cisplatin treatment.T98G glio-blastoma cells modified to express a nonphosphorylatable
dom-
F I
G .3.Sensitization of cells to cisplatin is general among cell types and stereospecific.A ,comparison of the viability of PC3hu-man prostate carcinoma cells modified to express pLHCX and the empty ve
ctor pMT64AA in the presence (f )or absence (q )of 25m M zinc acetate to clonal PC3cells the containing pLHCX and either the induc-ible vector pMTdnJun (ࡗ)or pMTTAM-67(å)both in the presence of 25m M zinc acetate.B ,the viability of parental and modified T98G cells in the presence of cisplatin (solid symbols )or transplatin (unfilled symbols
).
F I
G .4.Expression of the transdominant inhibitor,dnJun,blocks cisplatin-induced DNA repair.PCR results for the 2.7-kb segment of the hyopxanthine phosphoribosyl transferase gene was de-termined for 0,100,or 200M cisplatin for 1h as described (“Experi-mental Procedures”)and expressed as 1Ϫ(normalized efficiency of PCR amplification),a measure of cisplatin-induced lesions (10).A ,PCR results for T98G parental cells either immediately or 6h after treat-ment with cisplatin.The results are the averages of three assays for each of two independent preparations of DNA for the three concentra-tions of cisplatin.B ,comparison of T98G cells and dnJun-expressing cells 6h after treatment with cisplatin.The results are the averages of three assays.ABZ ,2-aminobenzidine.
T ABLE I
Sensitization of human tumor lines to cisplatin-induced cytotoxicity
IC 50values were determined by direct titration of viability with cisplatin as described (“Experimental Procedures”).None of the cell lines examined here were made cisplatin-resistant prior to analysis.
Cell
Control a
dnJun-expressing IC 50
Cisplatin sensitization b (IC 50)Parent /(IC 50)dnJun
IC 50
M M
T98G glioblastoma Parental
140Ϯ1321Ϯ37.0Empty vector pLHCX 154Ϯ137.60U87glioblastoma Parental
130Ϯ5350Ϯ5 2.6Empty vector pLHCX ND PC3prostate carcinoma Parental
109Ϯ1316Ϯ27.2Empty vector pMT64AA 156Ϯ189.2MCF-7breast carcinoma
Parental
145Ϯ2538Ϯ2
3.8Empty vector
pLHCX
101Ϯ9
2.7
a
In all cases parental and empty vector cells were analyzed in parallel and with equal concentrations of cisplatin and transplatin in the range 0–250M all in quadruplicate.Transplatin had no effect on viability of any cell.ND,not done.b
Sensitization is defined by the ratio of IC 50values for the parental or empty vector control cells to the IC 50value of the dnJun-expressing cells.
Inhibition of JNK/SAPK Sensitizes Tumor Cells to Cisplatin 14043
at TSINGHUA UNIVERSITY, on December 8, 2011
Downloaded from
inant negative inhibitor of c-Jun,dnJun,fail to repair cisplatin adducts and are sensitized to the cytotoxic effects of cisplatin under conditions that have little or no effect on parental and control lines.In contrast,cell lines modified to overexpress wild-type c-Jun are resistant to cisplatin,an observation that rules out that possibility that the sensitization effect of dnJun is mediated by one or more of the domains it shares with wild-type c-Jun.Moreover,sensitization to cisplatin by dnJun is exhibited by several cell lines of varying origins.Sensitiza-tion to cisplatin is also observed in PC-3prostate carcinoma cells modified to express TAM-67,a known dominant negative inhibitor of AP-1(21).Because the degree of protein expression and sensitization is similar for TAM-67and for dnJun,we conclude that most of the sensitization effects we observe are accounted for by inhibition of the phosphorylation-related func-tions of Jun.
Two major types of DNA regulatory elements that respond to the phosphorylation state of c-Jun include classic AP-1sites and ATF/CREB sites.Classic AP-1sites consisting of a7-base pair consensus motif,T(G/T)A(C/G)TCA,bind to AP-1com-plexes consisting of heterodimers of members
of the Fos and Jun families and to Jun-Jun homodimers(9,13–15,21,22,26). ATF/CREB sites consisting of an8-base pair consensus motif, T(G/A)CGTCA,bind to c-Jun/ATF2heterodimers.Indeed,be-cause JNK phosphorylates ATF2as well as c-Jun and promotes complex formation and binding to ATF/CREB sites,these sites are likely to be major targets of JNK-mediated regulation(9, 12,14,15).Several enzymes known to be involved in repair of DNA-cisplatin adducts and implicated in cisplatin resistance (20)contain ATF/CREB sites in their promoters including DNA polymerase(27,28),topoisomerase I(30,31),and proliferat-ing cell nuclear antigen,an accessory protein of DNA polymer-ase delta(32,33).Moreover,transcription of these genes is known to be activated through the ATF/CREB sites upon stim-ulation by genotoxic agents(27–33).Thus,the inhibition of induction of any or all of these activities could account for the inhibitory effects of dnJun on DNA repair and the resultant increase in cisplatin sensitivity.In view of the common regu-latory mechanism involving ATF/CREB sites,a concerted in-duction of genes with a related function,DNA repair,is sug-gested.The sum of results indicate,therefore,that a potential physiological role for the strong activation of the JNK/SAPK pathway following DNA damage may be to mediate DNA repair by enhancing transaction of DNA repair enzymes.
Acknowledgments—We thank M.Karin for providing the glutathione S-transferase-c-Jun and dnJun expression vectors and Eileen Adamson for critically reading this manuscript and for support.
Addendum—During the review of this manuscript we became aware that activation of JNK/SAPK by cisplatin has been reported by Liu et al. (Liu,Z.-G.,Baskaran,R.,Lea-Chou,E.T.,Wood,L.D.,Chen,Y.,Karin, M.,and Wang J.Y.J.(1996)Nature384,273–276).
REFERENCES
1.Smeal,T.,Bine´truy,B.,Mercola,D.A.,Birrer,M.,and Karin,M.(1991)Nature
354,494–496
2.Smeal,T.,Bine´truy,B.,Mercola,D.A.,Bardwick-Grover,A.,Heidecker,G.,
唐太宗十八学士Rapp,U.,and Karin,M.(1992)Mol.Cell.Biol.12,3507–3513
3.Bine´truy,B.,Smeal,T.,and Karin,M.(1991)Nature351,122–127
4.Pulverer,B.,Kyriakis,J.M.,Avruch,J.Nikolakakie,E.,and Woodgett,J.,
(1991)Nature353,670–674
5.De´rijard,B.,Hibi.M.,Wu I.-H.,Barrett,T.,Su,B.,Deng,T.,Karin,M.,and
Davis,R.,J.(1994)Cell76,1025–1037
6.Kyriakis,J.M.,Banerjee,P.,Nikolakaki,E.,Dai,T.,Rubie,E.A.,Ahmad,M.
F.,Avruch,J.,and Woodgett,J.R.(1994)Nature369,156–160
7.Hibi,M.,Lin,A.,Smeal,T.,Minden,A.,and Karin,M.(1993)Genes&Dev.7,
2135–2148
共产主义原理8.Adler,V.,Fuchs,S.,Y.Kim,J.,Kraft,A.,King,M.,P.Pelling,J.,and Ronai, Z.(1995)Cell Growth&Differ.6,1437–1446
9.Sluss,H.,Barrett,T.,De´rijard,B.,and Davis,R.J.(1994)Mol.Cell.Biol.14,
8376–8384
10.van Dam,H.,Wilhelm,D.,Herr,I.,Steffen,A.,Herrlich,P.,and Angel,P.
(1995)EMBO J.14,1798–1811
11.Adler,V.,Franklin,C.,and Kraft,A.(1992)Proc.Natl.Acad.Sci.U.S.A.89,
5341–5345
12.van Dam,H.,Duyndam,M.,Rottier,R.,Bosch,A.,de Vries-Smits,L.,Herrlich,
P.Zantema,A.,Angel,P.,and van der Eb,A.J.(1993)EMBO J.12,479–87 13.Whitmarsh,A.,Shore,P.,Sharrocks,A.,and Davis,R.J.(1995)Science269,
403–407
14.Davis,R.(1994)Trends Biochem.Sci.19,470–473
15.Xia,Z.,Dickens,M.,Raingeaud,J.,Davis.R.,and Greenberg,M.(1995)
Science270,1326–1331
16.Macgregor,P.F.,Abate,C.,and Curran,T.(1990)Oncogene5,451–458
17.Kharbanda,S.,Pandey,P.,Ren,R.,Mayer,B.,Zon,L.,and Kufe,D.(1995)
J.Biol.Chem.270,30278–30281
18.Yu,R.,Jiao,J.,Duh,J.,Tan,T.H.,and Kong,A.(1996)Cancer Res.56,
2954–2959
19.Sherman,S.E.,Gibson,D.,Wang,A.H.,and Lippard,S.J.(1985)Science230,洗脚
412–417
20.Zamble,D.B.,and Lippard,S.J.(1995)Trends Biochem.Sci.20,435–439
21.Brown,P.H.,Chen,T.K.,and Birrer,M.J.(1994)Oncogene9,791–799
22.Mercola,D.A.,Carpenter,P.,Grover-Bardwick,A.,and Mercola,M.(1992)
Oncogene7,1793–1803
23.Potapova,O.,H.Fakhrai,S.Baird and Mercola,D.(1996)Cancer Res.56,
280–286
24.Grover-Bardwick,A.,Adamson,E.,and Mercola,D.(1994)Carcinogenesis15,
1667–1674
25.Jennerwein,M.M.,and Eastman,A.(1991)Nucleic Acids Res.19,6209–6214
26.Karin,M.,and Smeal(1992)Trends Biochem.Sci.17,418–422
27.Kedar,P.S.Widen,S.G.,Englander,E.W.,Fornace,A.J.Jr.,and Wilson,S.
H.(1991)Proc.Natl.Acad.Sci.U.S.A.88,3729–3733
28.Horton,J.,Srivastava,D.Zmudzka,B.,and Wilson,S.H.(1995)Nucleic Acids
Res.23,3810–3815
29.Gjerset,R.,Turla,S.,Sobol,R.,Scalise,J.,Mercola,D.,Collins,H.,and
Isabella,P.(1995)Mol.Carcinogen.14,275–285
30.Heiland,S,.Knippers,R.,and Kunze,N.(1993)Eur.J.Biochem.217,813–822
31.Baumgartner,B.,Heiland,S.,Kunze,N.,Richter.A.,and Knippers,R.(1994)
Biochim.Biophys.Acta1218,123–127
32.Feuerstein,N.,Huang,D.,and Prystowsky,M.B.(1995)J.Biol.Chem.270,
9454–9458
33.Huang,D.,Shipman-Appasamy,P.M.,Orten,D.,J.,Hinrichs,S.H.,and
Prystowsky,M.B.(1994)Mol.Cell.Biol.14,4233–4243
Inhibition of JNK/SAPK Sensitizes Tumor Cells to Cisplatin
14044
at TSINGHUA UNIVERSITY, on December 8,
Downloaded from
豫公网安备41160202000603
站长QQ:729038198
关于我们
投诉建议