Please read the User Manual for the SMARTer® RACE 5’/3’ Kit (Cat. Nos. 634858, 634859) before using this Protocol-At-A-Glance. This abbreviated protocol is provided for your convenience, but is not intended for first-time users.
bg h
I. Primer Design (Section IV of the User Manual)
Gene-Specific Primers (GSPs) should:
∙be 23–28 nt to ensure specific annealing
∙be 50–70% GC
∙have a T m≥65°C; best results are obtained if T m >70°C, which enables the use of touchdown PCR. (T m should be calculated based upon the 3’ (gene-specific) end of the primer, NOT the entire primer.)
∙not be complementary to the 3’-end of the Universal Primer Mix
Long primer = 5’–TAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3'
Short primer = 5’–CTAATACGACTCACTATAGGGC–3’
∙be specific to your gene of interest
∙both have 15 bp overlaps with the vector at their 5’ end s to facilitate In-Fusion® cloning (i.e., add the sequence GATTACGCCAAGCTT to the 5’ end s of both GSPs’ sequences)
II. Generating RACE-Ready cDNA (Section V of the User Manual)
1.Prepare enough of the following Buffer Mix for all of the 5’- and 3’-RACE-Ready cDNA synthesis reactions
全球公民社会plus 1 extra reaction to ensure sufficient volume. Mix the following reagents and spin briefly in a microcentrifuge, then set aside at room temperature until Step 6:
4.0 µl 5X First-Strand Buffer
0.5 µl DTT (100 mM)
1.0 µl dNTPs (20 mM)
5.5 µl Total Volume
2.Combine the following reagents in separate microcentrifuge tubes:
For preparation of 5’-RACE-Ready cDNA For preparation of 3’-RACE-Ready cDNA
1.0–10 µl RNA* 1.0–11 µl RNA*
1.0 µl 5’-CDS Primer A 1.0 µl 3’-CDS Primer A
0–9 µl Sterile H2O 0–10 µl Sterile H2O
11 µl Total Volume 12 µl Total Volume
*For the control reactions, use 1 µl of Control Mouse Heart Total RNA (1 µg/µl).
3.Mix contents and spin the tubes briefly in a microcentrifuge.
4.Incubate tubes at 72°C for 3 minutes, then cool the tubes to 42°C for 2 minutes. After cooling, spin the tubes
briefly for 10 seconds at 14,000 x g to collect the contents at the bottom.
NOTE: This step can be performed in a thermal cycler. While the tubes are incubating, you can prepare the Master Mix in Step 6.
5.To just the 5’-RACE cDNA synthesis reaction(s), add 1 µl of the SMARTer II A Oligonucleotide per
reaction.
6.Prepare enough of the follo wing Master Mix for all 5’- and 3’-RACE-Ready cDNA synthesis reactions. Mix
these reagents at room temperatures in the following order:
5.5 µl Buffer Mix from Step 1
0.5 µl RNase Inhibitor (40 U/µl)
2.0 µl SMARTScribe™ Reverse Transcriptase (100 U)
8.0 µl Total Volume
7.Add 8 µl of the Master Mix from Step 6 to the denatured RNA from Step 4 (3’-RACE cDNA) and St
ep 5 (5’-
RACE cDNA), for a total volume of 20 µl per cDNA synthesis reaction.
8.Mix the contents of the tubes by gently pipetting, and spin the tubes briefly to collect the contents at the bottom.
9.Incubate the tubes at 42°C for 90 minutes in an air incubator or a hot-lid thermal cycler.
10.Heat tubes at 70°C for 10 minutes.
11.Dilute the first-strand cDNA synthesis reaction product with Tricine-EDTA Buffer:
∙Add 10 µl if you started with <200 ng of total RNA.
∙Add 90 µl if you started with >200 ng of total RNA.
∙Add 240 µl if you started with poly A+ RNA.
12.You now have 3’- and 5’-RACE-Ready cDNA samples. Samples can be stored at –20°C for up to three months. III. Rapid Amplification of cDNA Ends (RACE) (Section VI of the User Manual) This pr
ocedure describes the 5’-RACE and 3’-RACE PCR reactions that generate the 5’ and 3’ cDNA fragments.
We recommend that you also perform positive control 5’- and 3’-RACE using the TFR primers and UPM.
Although the Universal Primer Short (UPM short) is provided, nested PCR is generally not necessary in
SMARTer RACE reactions.
1.Prepare enough PCR Master Mix for all of the PCR reactions plus one extra reaction to ensure sufficient
volume. The same Master Mix can be used for both 5’- and 3’-RACE reactions. For each 50 µl PCR reaction,
mix the following reagents:
15.5 µl PCR-Grade H2O
25.0 µl 2X SeqAmp™ Buffer
1.0 µl SeqAmp DNA Polymerase
41.5 µl Total Volume
2.Prepare PCR reactions as shown below in Table 1. Add the components to 0.5 ml PCR tubes in the order
shown and mix gently.
Table 1. Setting up 5'- and 3'-RACE PCR Reactions
Component 5’- or 3’-RACE
Sample
UPM only
(– control)
GSP only
(– control)
5’- or 3’-RACE-Ready cDNA
(experimental)
2.5 µl 2.5 µl 2.5 µl
10X UPM 5 µl 5 µl —
5’ or 3’ GSP (10 µM) 1 µl — 1 µl
H2O — 1 µl 5 µl
Master Mix (Step 1) 41.5 µl 41.5 µl 41.5 µl
Total Volume 50 µl 50 µl 50 µl
3.Commence thermal cycling using one of the following PCR programs (both programs 1 and 2 work with the忆韦素园君
positive control 5’- and 3’-RACE TFR and UPM Primers). Be sure to choose the correct number of cycles (as noted) based on whether you started with poly A+ or total RNA.
NOTES ON CYCLING: You may need to determine the optimal cycling parameters for your gene
empirically, because the number of cycles necessary depends on the abundance of the target transcript. The optimal extension time depends on the length of the desired amplicon. For 0.2–2 kb amplicons, we typically extend for 2 minutes; for 2–4 kb amplicons, we extend for 3 minutes; and for 5–10 kb amplicons, we extend for up to 10 minutes.
NOTE: The T m sho uld be calculated based upon the 3’ (gene-specific) end of the primer, and NOT the entire primer.
Program 1 (touchdown PCR—preferred; use if GSP T m >70°C)
∙ 5 cycles:
94°C 30 sec
72°C 3 min*
∙ 5 cycles:
94°C 30 sec
70°C 30 sec
72°C 3 min*
∙20 cycles (Poly A+ RNA) OR 25 cycles (Total RNA):
94°C 30 sec
68°C 30 sec
72°C 3 min*
*If fragments >3 kb are expected, add 1 minute for each additional 1 kb.
Program 2 (use if GSP T m = 60–70°C)
20 cycles (Poly A+ RNA) OR 25 cycles (Total RNA):
94°C 30 sec
68°C 30 sec
72°C 3 min*
*If fragments >3 kb are expected, add 1 minute for each additional 1 kb.
IV. Characterization of RACE Products (Section VII of the User Manual)
A. Gel Extraction with the NucleoSpin Gel and PCR Clean-Up Kit
For more details on the included NucleoSpin Gel and PCR Clean-Up Kit, please download its User
Manual from our website at www.clontech/manuals.
Before you start: Add 24 ml of 96–100% ethanol to Wash Buffer NT3. Mark the label of the bottle to
indicate that ethanol was added. Wash Buffer NT3 is stable at room temperature (18–25°C) for at least
one year.
1.Electrophorese your RACE DNA sample on an agarose/EtBr gel. We recommend using a buffer
system containing either TAE (40 mM Tris-acetate [pH 8], 1 mM EDTA) or TBE (45 mM Tris-borate
[pH 8], 1 mM EDTA).
bs标准2.Locate the position of your fragment under UV light. Use a clean scalpel or razor blade to excise the
DNA fragment of interest. Cut close to the fragment to minimize the surrounding agarose. Estimate
the amount of DNA present in the gel slice.
NOTE: Minimize UV exposure time to avoid damaging the DNA.
3.Measure the weight of the gel slice and transfer it to a clean 1.5 ml microcentrifuge tube.
4.For each 100 mg of agarose, add 200 µl Buffer NTI.
5.Incubate the sample for 5–10 minutes at 50°C. Vortex every 2–3 minutes until the gel slice is
completely dissolved.
气动
真空阀
6.Place a NucleoSpin Gel and PCR Clean-Up Column into a Collection Tube (2 ml) and load up to700 µl of sample. Centrifuge for 30 seconds at 11,000 x g. Discard flow-through and place the
column back into the collection tube. Load remaining sample if necessary and repeat the
美国俄亥俄州
centrifugation step. 7.Add 700 µl Buffer NT3 to the column. Centrifuge for 30 seconds at 11,000 x g. Discard flow-through
and place the column back into the collection tube.
8.Centrifuge for 1 minute at 11,000 x g to remove Buffer NT3 completely. Make sure the spin column
does not come in contact with the flow-through while removing it from the centrifuge and collection
tube.
NOTE: Residual ethanol from Buffer NT3 might inhibit enzymatic reactions. Total removal of
ethanol can be achieved by incubating the columns for 2–5 minutes at 70°C prior to elution (Step 9).
9.Place the column into a new 1.5 ml microcentrifuge tube (not provided). Add 15–30 µl Buffer NE
and incubate at room temperature (18–25°C) for 1 minute. Centrifuge for 1 minute at 11,000 x g to
elute DNA.
NOTE: DNA recovery of larger fragments (>1000 bp) can be increased by multiple elution steps
with fresh buffer, heating to 70°C, and incubation for 5 minutes.
B. In-Fusion Cloning of RACE Products
For more details on the included In-Fusion HD Cloning Kit, please download its User Manual from our website at www.clontech/manuals.
1.Combine:
1 µl Lineareized pRACE vector (provided with SMARTer RACE 5’/3’ Kit Components)
7 µl Gel-purified RACE product
2 µl In-Fusion HD Master Mix
10 µl Total Volume
2.Incubate for 15 minutes at 50°C and transfer to ice.
3.Follow the protocol provided with your Stellar™ Competent Cells to transform the cells with 2.5 µl
of the In-Fusion reaction mixture.
IMPORTANT: DO NOT add more than 5 µl of the reaction to 50 µl of competent cells. More is not
better. Using too much of the reaction mixture inhibits the transformation.
4.Place 1/100–1/5 of each transformation reaction into separate tubes and bring the volume to 100 µl
with SOC medium. Spread each diluted transformation on a separate LB plate containing 100 µg/ml
of ampicillin.
5.Centrifuge the remainder of each transformation at 6,000 rpm for 5 minutes. Discard the supernatant
and resuspend each pellet in 100 µl fresh SOC medium. Spread each sample on a separate LB plate
containing the appropriate antibiotic. Incubate all of the plates overnight at 37°C.
6.The next day, pick individual isolated colonies from each experimental plate. Isolate plasmid DNA
using a standard method of your choice (e.g. miniprep). To determine the presence of your RACE
insert, analyze the DNA by PCR screening (with your GSPs) or restriction digest (with EcoRI and
HindIII, which flank the cloning site).
NOTE: For 5’-RACE products, we recommend picking at least 8–10 different independent clones in
order to obtain the maximum amount of sequence at the 5’end.
C. Sequencing RACE Products
Once you have identified the clones containing the largest gene-specific inserts, obtain as much sequence data as you can. Ideally, you will be able to sequence the entire open reading frame, as w
ell as the 5’ and 3’ untranslated regions.
豫公网安备41160202000603
站长QQ:729038198
关于我们
投诉建议