Promega Corporation
2800 Woods Hollow Road Madison, WI 53711-5399USA Telephone 608-274-4330Toll Free 800-356-9526Fax 608-277-2516Internet
www.promega
PRODUCT USE LIMITATIONS, WARRANTY,DISCLAIMER
Promega manufactures products for a number of intended uses. Please refer to the product label for the intended use statements for specific products.Promega products contain chemicals which may be harmful if misused. Due care should be exercised with all Promega products to prevent direct human contact.
Each Promega product is shipped with documentation stating specifications and other technical information.Promega products are warranted to meet or exceed the stated specifications. Promega's s
ole obligation and the customer's sole remedy is limited to replace-ment of products free of charge in the event products fail to perform as warranted. Promega makes no other warranty of any kind whatsoever, and SPECIFICALLY DISCLAIMS AND EXCLUDES ALL OTHER WAR-RANTIES OF ANY KIND OR NATURE WHATSOEVER,DIRECTLY OR INDIRECTLY, EXPRESS OR IMPLIED,INCLUDING, WITHOUT LIMITATION, AS TO THE
SUITABILITY, PRODUCTIVITY, DURABILITY, FITNESS FOR A PARTICULAR PURPOSE OR USE, MER-CHANTABILITY, CONDITION, OR ANY OTHER MAT-TER WITH RESPECT TO PROMEGA PRODUCTS. In no event shall Promega be liable for claims for any other damages, whether direct, incidental, foresee-able, consequential, or special (including but not lim-ited to loss of use, revenue or profit), whether based upon warranty, contract, tort (including negligence) or strict liability arising in connection with the sale or the failure of Promega products to perform in accordance with the stated specifications.
Part# 9PIE665Revised 2/09
Part# 9PIE665
Printed in USA. Revised 2/09pgl3
pGL4.10[luc2] Vector :
Part No.Size E665A
20µg
Description: The pGL4.10[luc2] Vector (a–d)encodes the luciferase reporter gene luc2(Photinus pyralis ) and is designed for high expression and reduced anomalous transcription. The pGL4 Vectors are engineered with fewer consensus regulatory sequences and a synthetic gene, which has been codon optimized for mammalian expression.
The pGL4.10[luc2] Vector is a basic vector with no promoter. However, it contains a multiple cloning region to allow cloning of a promoter of choice.Concentration: 1µg/µl.
GenBank ®Accession Number: AY738222.
Storage Buffer: The pGL4.10[luc2] Vector is supplied in 10mM Tris-HCl (pH 7.4), 1mM EDTA.
Storage Conditions:See the product information label for storage temperature recommendations. Avoid multiple freeze-thaw cycles and exposure to frequent temperature changes. These fluctuations
can greatly alter product stability. See the expiration date on the product information label.Usage Notes:
1.For easy transfer from one pGL4 Vector to another, the multiple cloning region is consistent throughout the pGL4 Vector series. For easy transfer between pGL3 Vectors and pGL4 Vectors, many of the restriction enzyme sites present in the pGL3 Vectors are also present in the pGL4 Vectors.
2.Concentration gradients may form in frozen products and should be dispersed upon thawing. Mix well prior to use.
Quality Control Assays
Nuclease Assay: Following incubation of 1µg of pGL4.10[luc2] Vector in standard restriction digest buffers at 37°C for
16–24 hours, no evidence of nuclease activity is detected by agarose gel electrophoresis.
Physical Purity:A 260/A 280≥1.80, A 260/A 250≥1.05 at pH 7.4.
Sequence: The pGL4.10[luc2] Vector has been completely sequenced and has 100% identity with the published sequence,
available at: w
w w w .p r o m e g a .c o m /v e c t o r s /© 2004–2009 Promega Corporation. All Rights Reserved.
GenBank is a registered trademark of the U.S.Department of Health and Human Services.Products may be covered by pending or issued patents or may have certain limitations. Please visit our Web site for more information.
All specifications are subject to change without prior notice.
Product claims are subject to change. Please contact Promega Technical Services or access the Promega online catalog for the most up-to-date information on Promega products.
AF9PI E665 0209E665
(a)READ THIS FIRST BEFORE OPENING PRODUCT
The sale of this product and its use by the purchaser are subject to the terms of a limited use label license, the full text of which
is shipped with this product and also available at: w
w w w .p r o m e g a .c o m \L U L L . That text must be read by the purchaser prior to opening this product to determine whether the purchaser agrees that all use of the product shall be in accordance with the
license terms. If the purchaser is not willing to accept the terms of the limited use label license, Promega is willing to accept the return of the unopened product and provide the purchaser with a full refund. However, if the product is opened for any reason,then the purchaser agrees to be bound by the terms of the limited use label license.(b)Australian Pat. No. 2001 285278 and other patents pending.(c)Patent Pending.
(d)The method of recombinant expression of Coleoptera luciferase is covered by U.S. Pat. Nos. 5,583,024, 5,674,713 and 5,700,673. A license (from Promega for research reagent products and from The Regents of the University of California for all other fields) is needed for any commercial sale of nucleic acid contained within or derived from this product.
Features List and Map for the pGL4.10[luc2] Vector
Multiple cloning region 1–70luc2reporter gene
100–1752SV40 late poly(A) region
1787–2008Reporter Vector primer 4 (RVprimer4) binding region 2076–2095
Col E1-derived plasmid replication origin 2333Synthetic β-lactamase (Amp r ) coding region 3124–3984Synthetic poly(A) signal/transcriptional pause site 4089–4242Reporter Vector primer 3 (RVprimer3) binding region
4191–4210
Promega Corporation · 2800 Woods Hollow Road·Madison, WI 53711-5399 U.S.A. ·Toll Free in the USA 800-356-9526 ·Telephone 608-274-4330 ·www.promega
Part# 9PIE665
Printed in USA. Revised 2/09
4721M A
9 15 18 24 26 28 34 42 47 60 66
5´...ACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT
GGCCTAACTGGCCGGTACCTGAGCTCGCTAGCCTCGAGGATATCAAGATCT
RVprimer3
SfiI BglI
BglII
NheI XhoI EcoRV Acc65I KpnI EcolCRI SacI
SfiI BglI HindIII F i g u r e 2. T h e m u l t i p l e c l o n i n g r e g i o n o f t h e p G L 4 V e c t o r s .
Sequence information and restriction enzyme tables for the pGL4 Vectors are available
online at: w
w w w .p r o m e g a .c o m /v e c t o r s /Further information on the use of pGL4 Vectors is available in Technical Manual #TM259,
which is available online at: w
w w w .p r o m e g a .c o m /t b s /