APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY
Homologous recombination in the antibiotic producer Penicillium chrysogenum :strain ΔPcku70shows up-regulation of genes from the HOG pathway
Birgit Hoff &Jens Kamerewerd &Claudia Sigl &Ivo Zadra &Ulrich Kück
Received:28April 2009/Revised:24July 2009/Accepted:25July 2009/Published online:19August 2009#Springer-Verlag 2009
Abstract In Penicillium chrysogenum ,the industrial pro-ducer of the β-lactam antibiotic penicillin,generating gene replacements for functional analyses is very inefficient.Here,we constructed a recipient strain that allows efficient disruption of any target gene via homologous recombina-tion.Following isolation of the Pcku70(syn.hdfA )gene encoding a conserved eukaryotic DNA-binding protein involved in non-homologous end joining (NHEJ),a Pcku70knockout strain was constructed using a novel nourseothricin-resistance cassette as selectable marker.In detailed physiological tests,strain ΔPcku70showed no significant reduction in vegetative growth due to increased sensitivity to different mutagenic substances.Importantly,deletion of the Pcku70gene had no effect on penicillin biosynthesis.However,strain ΔPcku70exhibits higher sensitivity to osmotic stres
s than the parent strain.This correlated well with comparative data from microarray
analyses:Genes related to the stress response are signifi-cantly up-regulated in the Pcku70deletion mutant.To demonstrate the applicability of strain ΔPcku70,three genes related to β-lactam antibiotic biosynthesis were efficiently disrupted,indicating that this strain shows a low frequency of NHEJ,thus promoting efficient homolo-gous recombination.Furthermore,we discuss strategies to reactivate Pcku70in strains successfully used for gene disruptions.
Keywords β-Lactam biosynthesis .Penicillium chrysogenum .Gene targeting .Non-homologous end joining .Pcku70.Velvet .pcbC .Pcrfx1.Array analysis .HOG-signalling pathway
Introduction
Functional genomics recently applied to fungi (Galagan et al.2005;Pel et al.2007)has underscored a significant number of candidate genes potentially involved in the regulation of secondary metabolism and morphogenesis.However,the rate-limiting step for functional molecular analysis of genes in filamentous fungi is the low gene targeting frequency due to a high rate of non-homologous end joining (van de Kamp et al.1999;Naranjo et al.2004).This is also true for Penicillium chrysogenum ,the main industrial producer of the pharmaceutically relevant β-lactam antibiotic penicillin.Although d
ifferent techniques for targeted gene disruption,such as the double marker gene replacement technique or transposon mutagenesis,have been developed in P.chrysogenum ,the rate of homologous recombination could not be increased to more than 1.6%(Casqueiro et al.1999;Liu et al.2001;Windhofer et al.2002).
Electronic supplementary material The online version of this article (doi:10.1007/s00253-009-2168-4)contains supplementary material,which is available to authorized users.
B.Hoff (*):J.Kamerewerd :U.Kück
Lehrstuhl für Allgemeine und Molekulare Botanik,Ruhr-Universität Bochum,Universitätsstraße 150,44780Bochum,Germany e-mail:birgit.hoff@rub.de
B.Hoff :J.Kamerewerd :U.Kück
Christian Doppler-Laboratory,Fungal Biotechnology,Ruhr-Universität Bochum,Universitätsstraße 150,44780Bochum,Germany C.Sigl :I.Zadra Sandoz GmbH,
Biochemiestraße 10,6250Kundl,Austria
Appl Microbiol Biotechnol (2010)85:1081–1094DOI 10.1007/s00253-009-2168-4
However,recent approaches have managed to significantly improve the efficiency of homologous recombination in filamentous fungi by destroying the non-homologous end-joining(NHEJ)process that promotes illegitimate recombi-nation(Ninomiya et al.2004).This process is mediated by a multi protein complex containing the DNA-dependent protein kinase(DNA-PK cs),the DNA ligase IV-XRCC4 complex,the exonuclease Artemis and the Ku70/Ku80 heterodimer,which binds tightly to DNA ends and directs the DNA-PK cs to allow efficient activation(Critchlow and Jackson1998;Hsu et al.2002;Meek et al.2004;Daley et al. 2005;Hefferin and Tomkinson2005).Disruption of one of the two genes,ku70or ku80,encoding these proteins has resulted in different fungal recipient strains where the frequency of homologous recombination is significantly increased to rates up to100%(Krappmann2007).
We aimed to apply this approach to the producer strain P. chrysogenum.A recipient with reduced NHEJ activity provides an opportunity to efficiently disrupt genes in-volved in the regulation of secondary metabolism and morphogenesis.In particular,a time-saving mechanism using homologous recombination will support large-scale reverse genetic approaches to deciphering mechanisms involved in the regulation ofβ-lactam antibiotic synthesis.
Here,we describe the generation of a P.chrysogenum strainΔPcku70using conventional knockout pro
cedures.A similar approach using the amdS gene encoding the acetamidase as a selectable marker was published recently while this paper was in preparation.The applicability of this knockout strain was proven by deleting the nitrate reductase gene(Snoek et al.2009).In contrast,we used with the nat1gene a dominant selectable marker for strain construction that proved to be useful when genes related to penicillin biosynthesis were deleted.Our results clearly demonstrate that the strainΔPcku70is a suitable recipient for highly efficient gene replacement experiments in this fungalβ-lactam antibiotic producer,without any quantita-tive changes in penicillin production,growth rate or sensitivity towards mutagens.Interestingly,comparative microarray analyses and osmotic stress tests indicate that in answer to reduced NHEJ activity,strainΔPcku70shows induced expression of genes involved in stress responses. Materials and methods
Strains and culture conditions Escherichia coli strain K12 XL1-Blue was used for general plasmid construction and maintenance(Bullock et al.1987).Cloning and propagation of recombinant plasmids were performed using standard protocols(Sambrook and Russell2001).P.chrysogenum P2niaD18is a derivative of strain P2obtained by random mutagenesis and carries a mutated niaD gene(Hoff et al.2008).This strain served as parental strain in all transfor-mation experiments.All P.chrysogenum strains were cultivated in liquid complete CCM or minimal MM medium at27°C and130rpm or on soli
d medium as already described(Minuth et al.1982;Haas et al.1997).In all cases,fresh spores were used to inoculate shake flasks and static liquid cultures.For transcript analysis,strains were cultivated on sterile membranes(Pall Life Sciences, NY,USA)on solid complete M322medium. Transformation of P.chrysogenum Transformation of P. chrysogenum was performed with some modifications as described by Windhofer et al.(2002).Cultures were inoculated with2:5À5Â106spores/ml CCM medium and grown at27°C and200rpm for48h.Fungal protoplasts were transformed with linear PCR or restriction fragments generated from plasmids pKOPcKU70,pKOPc-VELA,pKOPcRFX1and pKOPCBC,respectively.Trans-formants were selected either on nourseothricin(150µg/ml) or on nourseothricin and phleomycin(40µg/ml)containing CCM media.
Identification of P.chrysogenum genes and sequence analysis The genomic sequence of P.chrysogenum ATCC28089(van den Berg et al.2008)served as source for the sequences used here.The sequences for the P. chrysogenum pcbC(DQ192518)and penDE(DQ192518) gene,respectively,were obtained from the public database NCBI Entrez(www.cbi.v/entrez/).Protein sequence alignments were performed with ClustalX pro-gram(Thompson et al.1994)and displayed using GeneDoc (/gfx/genedoc/index.html).Conserved protein domains and motifs were predicted
using the SUPERFAMILY database(-lmb.cam.ac. uk/SUPERFAMILY/;Gough et al.2001),the PEST finder internet tool(emb1.bcc.univie.ac.at/toolbox/pestfind/ pestfind-analysis-webtool.htm),the computer program WoLF PSORT(/)and NetNES 1.1 Server(www.cbs.dtu.dk/services/NetNES/;la Cour et al.2004).
Construction of knockout plasmids The sequences and specificities of all oligonucleotides used in this study are given in Table1.For disruption of the Pcku70gene in P. chrysogenum,plasmid pKOPcKU70was constructed as follows:fragments of the5′and3′flanking regions of the Pcku70gene were amplified using primers Pcku70-5s and Pcku70-5a as well as Pcku70-3s and Pcku70-3a,respec-tively,and genomic DNA of strain P2niaD18as a template. PCR fragments were subcloned into plasmid pDrive (Qiagen,Hilden,Germany)and sequenced(Eurofins MWG Operon,Ebersberg,Germany).Subsequently,the 1,023bp Pst I–Bam HI fragment encoding the5′-Pcku70
region was inserted into the corresponding sites of plasmid pD-NAT1(Kück and Hoff2006).Plasmid pD-NAT1 contains the nat1gene encoding the nourseothricin acetyl-transferase under the control of the trpC promoter of Aspergillus nidulans.The resulting plasmid pKOPcKU70-5′includes the5′region of the Pcku70gene adjacent to the nourseothricin-resistance cassette.Subsequently,the 1,213bp Hin
dIII–Xba I3′-fragment of the Pcku70gene was cloned downstream of the nourseothricin-resistance cassette.Digestion of the resulting plasmid pKOPcKU70 with Pst I and Xba I resulted in a 3.2-kb replacement fragment used for transformation of P.chrysogenum P2niaD18to obtain a knockout of the Pcku70gene by homologous recombination(Fig.1a).
For construction of the PcvelA replacement vector pKOPcVELA,1,206bp of the5′and1,262bp of the3′region of the gene were amplified by PCR with primers PcvelA-5s and PcvelA-5a as well as PcvelA-3s and
Table1Oligonucleotides used in this study
Oligonucleotide Sequence(5′–3′)Specificity
Pcku70-5s CTGCAGATCCTCCATTTGCGCGCTTTCCCTCG5′flanking region of Pcku70 Pcku70-5a GGATCCTGTTACGAAGTAGGTATCCTCGGGAG5′flanking region of Pcku70 Pcku70-3s AAGCTTACATTGATTTGAAGTTTGCTCAGGATC3′flanking region of Pcku70 Pcku70-3a TCTAGACACCAGGACAAGCAGTCAAGTCAACG3′flanking region of Pcku70 PcvelA-5s GAGAGCATGCGGCTTGAATGTCAAAGCGAATCAC5′flanking region of PcvelA PcvelA-5a CACAGGATCCTTTCGCGGATTGATGTTGTTATTCC5′flanking region of PcvelA PcvelA-3s GAGAGA
ATTCGACCTGCGATTGCCTCAAATATC3′flanking region of PcvelA PcvelA-3a CACAAAGCTTCCATCTTGGAGTCGCGGGCACTG3′flanking region of PcvelA Pcrfx1-5s CACACTGCAGACATCACAGCCCTACTGGATTGGA5′flanking region of Pcrfx1 Pcrfx1-5a CACAGGATCCCTTGCTCTGCTTCGTTGAGTTAGT5′flanking region of Pcrfx1 Pcrfx1-3s CACAGAATTCTCTGATTTTTGATTTCTGTTCATG3′flanking region of Pcrfx1 Pcrfx1-3a CACAGAATTCTGTAAAACGAACAACTTCCCCCT3′flanking region of Pcrfx1 pcbC-3s CACAGCTAGCAAGGGCCCATGGATGGGACCGGGATG3′flanking region of pcbC pcbC-3a GTGTGCTAGCACGGAGGCGATAACAGCCAGCCTGG3′flanking region of pcbC P1CGACGCCTGTTTGTCGTGACCGACAACG Pcku70gene
P2ATAATGCCATTGAAGCGAAGGATTCGGATA Pcku70gene
P3CCAATCTCCCGAGGATACCTACT5′flanking region of Pcku70 P4CCAAGACGATCCTGAGCAAACTT3′flanking region of Pcku70 P5CTCCTCTGGGTAGGTCTTAAGCTG5′flanking region of Pcku70 P6GGCATTCATTGTTGACCTCCACTAG trpC promoter
P7CGCTCTACATGAGCATGCCCTGC nat1resistance gene
P8CCCCCAGGTGGCCAAAGCATCTT3′flanking region of Pcku70 RT6250-for TCCAACAACTCGAAGCCTGA Pc20g06250gene
RT6250-rev CCATGCGTCAACATCGTCTT Pc20g06250gene
RT6270-for GGAGAATATCGCTCGCAAGG Pc20g06270gene
RT6270-rev GCTCGAAGCTTCCTCCTGAA Pc20g06270gene
RT6280-for TTGACCCCCAAGCTTTGTTT Pc20g06280gene
RT6280-rev GTCTCGACGACAGCAAGTGG Pc20g06280gene
RT6300-for CTCGGCCATACCAGAAGAGG Pc20g06300gene
RT6300-rev CGCTCTTTCCTTTGCCTTTG Pc20g06300gene
RT6340-for GGCCACGACGTACGACAATA Pc20g06340gene
RT6340-rev GATGAGTCGAGTGGCACCAG Pc20g06340gene
RT6350-for GTGAGCATGAGCTGGTAGTC Pc20g06350gene
RT6350-rev AGCCCGTTTCAATGACTGGT Pc20g06350gene
RT6360-for AGCAGAGACCGTGGAATGGT Pc20g06360gene
RT6360-rev CGTCCAGTTCACGCTGGTAG Pc20g06360gene
RT6370-for GGCATCGCTGATGTGATAGC Pc20g06370gene
RT6370-rev GGAACTCATAGACCGCACGA Pc20g06370gene
PcvelA-3a,respectively,and the resulting amplicons were cloned into plasmid pDrive.Subsequently,the Sph I –Bam HI 5′-fragment and the Eco RI –Hin dIII 3′-fragment were ligated into the corresponding sites of vector pD-Phleo.In this plasmid,expression of the phleomycin-resistance gene ble is controlled by the trpC promoter of A.nidulans .The resulting plasmid pKOPcVELA was then used as a template to amplify the PcvelA-ble cassette with oligonucleotides PcvelA-5s and PcvelA-3a.The 3.2-kb PCR fragment obtained was used for transformation of strain ΔPcku70to generate a PcvelA knockout strain.
Similarly,plasmid pKOPcRFX1was constructed for generation of Pcrfx1deletion strains.One thousand two hundred base pairs of the 5′and 1,109bp of 3′regions of the gene were amplified by PCR with pri
mers Pcrfx1-5s/Pcrfx1-5a and Pcrfx1-3s/Pcrfx1-3a,respectively,and the resulting amplicons were cloned into plasmid pDrive.Subsequently,the Pst I –Bam HI 5′-fragment and the Eco RI 3′-fragment were ligated into the corresponding sites of vector pD-Phleo.The targeting replacement fragment of 3,069bp was amplified by PCR and used for transforma-tion of strain ΔPcku70.For generation of the replacement vector pKOPCBC,we have performed PCR amplification with primers pcbC-3s and pcbC-3a to generate a 1,211-bp amplicon of the 3′region of the pcbC gene that was then
subcloned into vector pDrive.Subsequently,the 1,211bp Nhe I fragment encoding the 3′pcbC -fragment was inserted into the Nhe I site of plasmid pD-PpcbC-Phleo.In this plasmid,expression of the phleomycin-resistance gene is controlled by the pcbC promoter,which represents the 5′region of the pcbC gene.The resulting plasmid was named pKOPCBC.Digestion of this plasmid with Pvu I and Bam HI resulted in a 2.7-kb replacement fragment used for transformation of protoplasts of P .chrysogenum strain ΔPcku70.
Preparation of nucleic acids,hybridisation protocols and PCR Fungal genomic DNA and RNA isolation for South-ern and Northern blotting experiments was carried out as previously described (Jekosch and Kück 2000).DNA/RNA was isolated from hyphal cells grown at 27°C and 130rpm for 3days in liquid CCM medium.RNA extraction for microarray-and quantitative reverse transcriptase (q
RT)PCR analysis from mycelia grown on solid M322medium was done using the TRIzol solution (Invitrogen,Germany)and RNeasy kit (Qiagen,Hilden,Germany)according to the manufacturer ’s protocol.For PCR analysis,genomic DNA of fungal transformants was isolated by solubilising approximately 1to 2cm 2of mycelia with liquid nitrogen,followed by the addition of 300µl hot extraction buffer
(0.2
Fig.1Molecular characterisation of strain ΔPcku70.a Genomic organisation of the P .chrysogenum Pcku70locus from the recipient P2niaD18and the derived knockout strain.b PCR analysis of strain ΔPcku70compared to the parental strain P2niaD18.Primers were
used as indicated in a .c Southern hybridisation of strain ΔPcku70using the 5′region of the Pcku70gene as well as the nat1gene as radiolabelled probes
boric acid,30mM EDTA,1%SDS,pH9)and incubation at70°C for10min.After addition of200µl of3M sodium acetate(pH 5.2),freezing at−20°C and centrifugation, DNA contained in the supernatant was precipitated by the addition of isopropanol and incubation at−20°C.The pellets were washed with70%ethanol,dried and resus-pended in70µl of water.
PCR amplification was carried out with the HotMaster DNA polymerase(Eppendorf,Hamburg,Germany)accord-ing to the manufacturer’s instructions.Southern/Northern blotting was performed with GeneScreen hybridisation transfer membrane according to the manufacturer’s instruc-tions(PerkinElmer,Boston,USA).Filters were hybridised with[α-32P]dCTP-labelled probes using standard methods. All techniques were conducted
according to Sambrook and Russell(2001).Quantification of hybridisation signals were carried out using the computer program Scion Image-Release Beta4.0.2.
Measurement of penicillin titres For quantification of penicillin titres,culture broth from100ml liquid shake flask cultures,grown in production medium,was used for high-performance liquid chromatography(HPLC).Quanti-fication of penicillin synthesis was performed as previously described in triplicate(Schmitt et al.2004).
Assay for measuring sensitivity to DNA-damaging agents, osmotic and oxidative stress,as well as temperature Growth of mycelia was monitored as dry cell weight.At the assigned cultivation times(24–168h),the dry weight of each sample was estimated by vacuum filtration of a100ml liquid culture.The remaining cell material was dried at60°C for24h,and the dry weight was determined resulting in mean values of three independent measurements.Mutagen sensitivity of the strainΔPcku70compared with the recipient P2niaD18was determined with plate assays using conidial suspensions.The strains were inoculated on CCM media supplemented with40–150µg/ml phleomycin,0.1–10µl/ml ethyl methanesulfonate(EMS)and50–150ng/ml 4-nitroquinoline1-oxide(4-NQO),respectively.Addition-ally,sensitivity of conidia to UV radiation was analysed at 120–375J/m2.Growth of all strains was monitored after 5days of cultivation.To test the sensitivity to osmoti
c stress,10µl of a1×107/ml spore suspension of strains P2niaD18,ΔPcku70,transformants P2nat1ect-T1and T2as well as Pcku70complements was spotted on minimal medium containing increasing concentrations of NaCl or KCl and incubated for120h at27°C.For oxidative stress tests,400µl of a5×106/ml spore suspension of P2niaD18 and strainΔPcku70were spread on complete and minimal media.On each plate,four holes were cut out and filled with25,50,100and150µl of a1%H2O2solution.The plates were incubated for168h at27°C,and the diameters of the zones of inhibition were measured.All assays were carried out as triplicate.
Microarray analysis For microarray analysis,the custom-designed Affymetrix GeneChip®DSM_PENa520255F rep-resenting the genome of P.chrysogenum Wisconsin54-1255 was used(van den Berg et al.2008).In a time-course analysis,samples from parental strain P2niaD18and mutant strainΔPcku70were isolated after48,60and96h of growth.From three biological replicates,mRNA was isolated and pooled to synthesise a single cDNA sample, which was used for array hybridisation.Differentially expressed genes were determined with the R-package affylmGUI(Wettenhall et al.2006)by using the imple-mented RMA algorithm for preprocessing the raw data (Irizarry et al.2003a;Irizarry et al.2003b)and the limma-package for assessing differential expression(Smyth2004). Quantitative real-time PCR For quantitative real-time PCR, RNA extracted fr
om three biological replicates(see Micro-array analysis)was used to synthesise cDNA as described previously(Nowrousian et al.2005)with the following modifications:2µg of total RNA was treated with30U DNaseI(Roche Applied Science,Germany),RT was per-formed with400U of Superscript II(Invitrogen,Germany) and desoxynucleoside triphosphates at a concentration of 0.33mM.As a control for successful DNase treatment,each reverse transcription was carried out twice,once with and once without reverse transcriptase.Real-time PCR was carried out with a DNA Engine Opticon2(MJ Research, MA,USA).Real-time PCR experiments with each replicate and primer pair were carried out three times.Data analysis was done according to Nowrousian et al.(2005).
Results
Isolation of the Pcku70gene PCR amplification using homologous primers,as described in“Materials and methods”,led to the isolation of the P.chrysogenum Pcku70gene(syn.hdfA,CAP98839).This gene encodes a protein of658amino acids with a predicted molecular mass of73.3kDa,which is very similar to Ku70proteins from other fungal species.Alignment of the predicted P. chrysogenum Pcku70amino acid sequence with the corresponding amino acid sequences from Neurospora crassa Mus-51,Sordaria macrospora Ku70,Aspergillus fumigatus Ku70and human Ku70shows an identity between46%and65%,with the A.fumigatus Ku70as the closest homologue(supplementary Fig.1S).Th
e25% homology of Pcku70to the human Ku70protein under-scores previous findings that the Ku70subunit is a
conserved protein found in vertebrates,invertebrates,plants and fungi(Krappmann2007).
For further in silico characterisation,the Pcku70protein was submitted to the SUPERFAMILY database(Madera et al.2004),allowing detection of three possible functional domains:the N-terminal“von Willebrand”A(vWA)-like domain(aa27–276),the Ku70core domain(aa280–546) and the C-terminal SAP domain(aa606–656).While the SAP domain represents the putative DNA-binding motif (Aravind and Koonin2000),the vWA domain most probably mediates protein–protein interactions such as heterodimerisation between Ku70and Ku80,as well as interactions with other proteins involved in the NHEJ machinery.This domain structure is conserved in all characterised Ku70orthologues of higher eukaryotic origin (Aravind and Koonin2001;Whittaker and Hynes2002).In summary,the sequence similarity,as well as the conserved functional domains in Ku70orthologues,verified that we have isolated the P.chrysogenum Pcku70gene involved in the NHEJ pathway.
Construction and molecular characterisation of a Pcku70 knockout strain Using conventional knocko
ut procedures, we deleted the Pcku70gene to generate a P.chrysogenum recipient strain for efficient gene targeting.First,we constructed a gene replacement fragment where the nat1 gene is flanked on each side by1.0to1.2kb of upstream and downstream genomic sequences from the Pcku70locus (Fig.1a).In this context,it is worth mentioning that the nourseothricin-resistance gene nat1is a novel selectable marker in P.chrysogenum,which was successfully used here for the first time.The 3.2-kb gene replacement fragment was transferred into the P2niaD18recipient strain, and homologous recombination of this fragment into the P. chrysogenum genome results in the substitution of the Pcku70gene by the nat1gene.
Using a previously described PCR-based screening procedure and two rounds of single-spore isolation(Pögg-eler and Kück2006),out of252tested transformants,we identified a single genetically purified isolate that showed the PCR amplification products predicted for a homokary-otic Pcku70deletion strain.As can be seen in Fig.1b,the use of primers binding in the Pcku70coding sequence leads to an amplicon of1kb in the recipient P2niaD18.As expected,no amplification product was observed in strain ΔPcku70.Verification of the homologous integration event came from a further PCR experiment.Primers located either outside the targeted gene or inside the nat1resistance cassette were used to generate1.2-and1.4-kb fragments, respectively.Both amplicons are indicative f
or the disrup-tion event occurring in strainΔPcku70,while the recipient P2niaD18lacks any amplicon.These data were further confirmed by Southern hybridisation experiments(Fig.1c).
In conclusion,all hybridisation profiles obtained were consistent with a single homologous recombination and integration event at the Pcku70locus.The homologous recombination frequency in this experiment corresponds to about0.4%.Thus,strainΔPcku70can be considered as an attractive recipient for further gene deletion experiments. Phenotypic characterisation of the strainΔPcku70The recipient strainΔPcku70was examined for phenotypic defects with respect to vegetative growth,sensitivity to DNA-damaging agents,UV radiation,osmotic and oxida-tive stress,as well as penicillin production.Comparison of the biomass produced by the parental strain P2niaD18and strainΔPcku70showed that Pcku70deletion has no apparent effect on the vegetative growth rate(Fig.2a).In this study,sensitivity to the DNA-damaging agents phleo-mycin,EMS and4-NQO as well as UV radiation was examined with spot tests using conidial suspensions.In all cases,sensitivities to these mutagens were not significantly different between the Pcku70deletion mutant and the parental strain,suggesting the existence of a Ku-independent pathway to repair DNA double-strand breaks (Fig.2b).This hypothesis was further supported by the fact that both strains showed identical temperature sensitivities and exhibited no differences in oxidative stress response s
tudies using H2O2as an agent(Fig.2c).Interestingly,we observed a higher sensitivity of strainΔPcku70to osmotic stress compared to P2niaD18.The growth of mutant ΔPcku70was completely inhibited on minimal medium at elevated concentrations of either NaCl or KCl,while the parental P2niaD18strain showed growth even at higher salt concentrations(Fig.2d).As a control,two independent recombinant P.chrysogenum strains P2nat1ect-T1and T2 were inoculated,carrying the ectopically integrated nat1 gene to exclude the possibility that the presence of the resistance marker gene in strainΔPcku70is responsible for the observed growth phenotype.As shown in Fig.2d,both ectopical transformants have a higher osmotic stress tolerance than strainΔPcku70.An identical observation was done when two complements of strainΔPcku70, carrying the ectopically integrated Pcku70gene,were tested on elevated concentrations of either NaCl or KCl(data not shown).When grown on plates with distinct salt concen-trations,we found that differences in growth behaviour are best observed on plates containing0.8M NaCl or KCl (supplementary Fig.2S).As described later,these data are consistent with the results obtained with microarray analysis.
Importantly,we found no significant differences when the penicillin titre from strains P2niaD18andΔPcku70 were determined using HPLC analysis(Fig.2e).This is an essential prerequisite for functional investigation of genes related to penicillin biosynthesis.
>p.r.s
豫公网安备41160202000603
站长QQ:729038198
关于我们
投诉建议