pLKOshRNA病毒质粒载体构建protocol方法详解

D. Screening for Insertso D.1 Recommended materialsPlasmid CartYour cart is ly ViewedpLKO.1 - Plasmid 10878pLVTHMPlasmid 12247Mammalian Collectiono D.2 Screening for inserts E. Producing Lentiviral Particleso E.1 Recommended materialso E.2 Protocol for producing lentiviral particles ? F. Infecting Target Cellso F.1 Recommended materialso F.2 Determining the optimal puromycin concentrationo F.3 Protocol for lentiviral infection and selection ?G. SafetyH. Referenceso H.1 Published articleso H.2 Web resourcesI. Appendixo I.1 Sequence of pLKO.1 TRC-Cloning Vectoro I.2 Recipeso I.3 Warranty informationBack to TopA. pLKO.1-TRC Cloning VectorA.1 The RNA i ConsortiumThe pLKO.1 cloning vector is the backbone upon which The RNAi Consortium (TRC) has built a library of shRNAs directedagainst 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vectoravailable to the scientific community. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed) in all publicationsarising from the use of this vector.A.2 Map of pLKO.1pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. pLKO.1 can beintroduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cellline. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection.

A.3 Related ProductsThe following plasmids available from Addgene are recommended for use in conjunction with the pLKO.1 : pLKO.1 can also be used with packaging plasmid pCMV-dR8.2 dvpr (Addgene #8455) and envelope plasmid pCMV-VSVG (Addgene#8454) from Robert Weinberg's lab. For more information, visit Addgene's Mammalian RNAi Tools l other laboratories have deposited pLKO derived vectors that may also be useful for your experiment. To see thesevectors, visit Addgene's website and search for "pLKO".Back to TopB. Designing shRNA Oligos for pLKO.1

B.1 Determining the Optimal 21-mer Targets in your GeneSelection of suitable 21-mer targets in your gene is the first step toward efficient gene silencing. Methods for target selectionare continuously being improved. Below are suggestions for target selection.1. Use an siRNA selection tool to determine a set of top-scoring targets for your gene. For example, the Whitehead Institutefor Biomedical Research hosts an siRNA Selection Program that can be accessed after a free registration(/doc/ /bioc/siRNAext/). If you have MacOS X, another excellentprogram is iRNAi, which is provided free by the company Mekentosj(/doc/ /irnai/).A summary of guidelines for designing siRNAs with effective gene silencing is included here:Starting at 25nt downstream of the start codon (ATG), search for 21nt sequences that match the pattern AA(N19). If nosuitablematch is found, search for NAR(N17)YNN, where N is anynucleotide, R is a purine (A,G), and Y is a pyrimidine (C,U).G-C content should be 36-52%.Sense 3' end should have low stability – at least one A or T between position targeting stretches of 4 or more nucleotide repeats, especially repeated Ts because polyT is a termination signal for RNApolymerase III.2. To minimize degradation of off-target mRNAs, use NCBI's BLAST program. Select sequences that have at least 3nucleotide mismatches to all unrelated e recommends that you select multiple targetsequences for each gene. Some sequences will be more effectivethan others. In addition, demonstrating that two different shRNAsthat target the same gene can produce the same phenotype willalleviate concerns about off-target effects.B.2 Ordering Oligos Compatible with pLKO.1To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into the oligos not change the ends; these bases are important for cloning the oligos into the pLKO.1 TRC-cloning d oligo:5' CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3'Reverse oligo:5' AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3'For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be:Forward oligo:5'CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTA GGCATT TTTTTG 3'Reverse oligo:

5'AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTA ACGTAGGCATT 3'Back to TopC. Cloning Oligos into pLKO.1The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is releasedupon digestion with EcoRI and oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky ends ofEcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, producing a final plasmid thatexpresses the shRNA of interest.C.1 Recommended MaterialsC.2 A nnealing Oligos1. Resuspend oligos in ddH2O to a concentration of 20 µM, then mix:5 µL Forward oligo5 µL Reverse oligo5 µL10x NEB buffer 235 µL ddH2O2. Incubate for 4 minutes at 95o C in a PCR machine or in a beaker of boiling water.3. If using a PCR machine, incubate the sample at 70o C for 10 minutes then slowly cool to room temperature over the periodof several hours. If using a beaker of water, remove the beaker from the flame, and allow the water to cool to roomtemperature. This will take a few hours, but it is important for the cooling to occur slowly for the oligos to anneal.C.3 Digesting pLKO.1 TRC Cloning Vector1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:6 µg pLKO.1 TRC-cloning vector (maxiprep or miniprep DNA)5 µL10x NEB buffer 11 µL AgeIto 50 µL ddH2O> Incubate at 37o C for 2 hours.

2. Purify with Qiaquick gel extraction kit. Elute in 30 µL of ddH2O.3. Digest eluate with EcoRI. Mix:30 µL pLKO.1 TRC-cloning vector digested with AgeI5 µL10x NEB buffer for EcoRI1 µL EcoRI14 µL ddH2O> Incubate at 37o C for 2 hours.4. Run digested DNA on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cutout the 7kb band and place in a sterile microcentrifuge visualizing DNA fragments to be used for ligation, useonly long-wavelength UV light. Short wavelength UV light willincrease the chance of damaging the DNA.5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 µL of ddH2O.6. Measure the DNA concentration.C.4 Ligating and Transforming into Bacteria1. Use your ligation method of choice. For a standard T4 ligation, mix:2 µL annealed oligo from step C.2.20 ng digested pLKO.1 TRC-cloning vector from step C.3. (If you were unable to measure the DNA concentration, use 1 µL)2 µL10x NEB T4 DNA ligase buffer 1 µL NEB T4 DNA ligaseto 20 µL ddH2O> Incubate at 16o C for 4-20 hours.2. Transfo rm 2 µL of ligation mix into 25 µL competent DH5 alpha cells, following manufacturer's protocol. Plate on LB agarplates containing 100 µg/mL ampicillin or carbenicillin (an ampicillin analog).Back to TopD. Screening for InsertsYou may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, once you haveidentified the positive clones, it is important to verify the insert by conducting a sequencing reaction.D.1 Recommended MaterialsD.2 Screening for InsertsDay 1:

1. Innoculate 5 colonies from each ligation into LB + 100 µg/mLampicillin or 2:2. Spin down the cultures and use a miniprep kit to obtain DNA.3. Conduct a restriction digest with EcoRI and NcoI:1 µg miniprep DNA2 µL10x NEB buffer for EcoRI0.8 µL EcoRI0.8 µL NcoIto 20 µL ddH2O> Incubate at 37o C for 1-2 hours.4. Run the digestion products on a 1% agarose gel. You shouldsee two fragments, a 2kb fragment and a 5kb fragment.5. Sequence positive clones with pLKO.1 sequencing primer (5'CAA GGC TGT TAG AGA GAT AAT TGG A 3').You may need to adjust the sequencing conditions if theDNA polymerase has difficulty reading through thesecondary structure of the hairpin to TopE. Producing Lentiviral ParticlesBefore this step, you must contact your institution's Bio-Safety office to receive permission and institution-specificinstructions. You must follow safety procedure s and work in an environment (e.g. BL2+) suitable for handling HIV-derivativeviruse transient knockdown of protein expression, you may transfect plasmid DNA directly into the target cells. The shRNA willbe expressed, but the DNA is unlikely to be integrated into the host stable loss-of-function experiments, Addgene recommends that you generate lentiviral particles and infect the targetcells. Addition of puromycin will allow you to select for cells that stably express your shRNA of interest.E.1 Recommended Materials

Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For moreinformation, visit Addgene's Mammalian RNAi Tools page.E.2 Protocol for Producing Lentiviral ParticlesThis protocol is for transfection in a 6 cm plate. The protocol can be scaled to produce different amounts of virus as 1:a. For each plasmid to be transfected, plate 7x105 HEK-293T cellsin 5 mL of media in a 6 cm tissue culture plate. Incubate cells at37o C, 5% CO2 gh cells should regularly be passaged in DMEM +10% FBS with penicillin/streptomycin, cells should beplated at this step in DMEM + 10% FBS without antibiotics(no penicillin or streptomycin).Day 2:b. Perform the transfection in the late afternoon because thetransfection mix should only be incubated with the cells In polypropylene microfuge tubes (do NOT use polystyrenetubes), make a cocktail for each transfection:1 µg pLKO.1 shRNA plasmid750 ng psPAX2 packaging plasmid250 ng pMD2.G envelope plasmidto 20 µl serum-free OPTI-MEMYou may want to vary the ratio of shRNA plasmid,packaging plasmid, and envelope plasmid to obtain theratio that gives you the optimal viral production.d. Create a master mix of FuGENE? 6 transfection reagent inserum-free OPTI-MEM. Calculate the amount of Fugene? andOPTI-MEM necessary given that each reaction will require 6 µLFuGENE? + 74 µL OPTI-MEM. For example:1x master mix: 6 µL FuGENE? + 74 µL OPTI-MEM

5x master mix: 30 µL FuGENE? + 370 µL OPTI-MEM10x master mix: 60 µL FuGENE? + 740 µL OPTI-MEM In a polypropylene tube, add OPTI-MEM first. Pipette FuGENE?directly into the OPTI-MEM - do not allow FuGENE? to come incontact with the walls of the tube before it has been diluted. Mix byswirling or gently flicking the tube. Incubate for 5 minutes Add 80 µL of FuGENE? master mix to each tube from step c fora total volume of 100 µL. Pipette master mix direct ly into the liquidand not onto the walls of the tube. Mix by swirling or gently flickingthe tube.f. Incubate for 20-30 minutes at Retrieve HEK-293T cells from incubator. The cells should be50-80% confluent and in DMEM that does not contain antibiotics.h. Without touching the sides of the dish, gently addDNA:FuGENE? mix dropwise to cells. Swirl to disperse mixtureevenly. Do not pipette or swirl too vigorously, as you do not wantto dislodge the cells from the plate.i. Incubate cells at 37o C, 5% CO2 for 12-15 3:j. In the morning, change the media to remove the transfectionreagent. Replace with 5 mL fresh DMEM + 10% FBS +penicillin/streptomycin. Pipette the media onto the side of the plateso as not to disturb the transfected cells.k. Incubate cells at 37o C, 5% CO2 for 24 4:l. Harvest media from cells and transfer to a polypropylenestorage tube. The media contains your lentiviral particles. Store Add 5 mL of fresh media containing antibiotics to the cells andincubate at 37o C, 5% CO2 for 24 5:n. Harvest media from cells and pool with media from Day 4. Spinmedia at 1,250 rpm for 5 minutes to pellet any HEK-293T cellsthat were inadvertently collected during harvesting.

In lieu of centrifugation, you may filter the media througha 0.45 µm filter to remove the cells. Do not use a 0.2 µmfilter, as this is likely to shear the envelope of Virus may be stored at 4o C for a few days, but should be frozenat -20o C or -80o C for long-term /thaw cycles decrease the efficiency of the virus,so Addgene recommends that you use the virusimmediately or aliquot the media into smaller tubes toprevent multiple freeze/thaw to TopF. Infecting Target CellsLentiviral particles can efficiently infect a broad range of cell types, including both dividing and non-dividing cells. Addition ofpuromycin will allow you to select for cells that are stably expressing your shRNA of interest.F.1. Recommended Materials* Detailed protocols for preparing polybrene, protamine sulfate, andpuromycin are located in the Appendix.F.2. Determining the Optimal Puromycin ConcentrationEach cell line responds differently to puromycin selection. Addgene strongly recommends that you determine the optimalpuromycin concentration for your cell line before initiating your 1:a. Plate target cells in ten 6 cm plates and grow at 37o C, 5% 2:b. The target cells should be approximately 80-90% Dilute puromycin in the preferred culture media for your targetcells. The final concentration of puromycin should be from 1-10µg/mL in 1 µg/mL increments.d. Label plates from 1-10 and add appropriate

puromycin-containing media to 3+:e. Examine cells each day and change to freshpuromycin-containing media every other day.f. The minimum concentration of puromycin that results incomplete cell death after 3-5 days is the concentration that shouldbe used for selection in your experiments. (You may wish torepeat this titration with finer increments of puromycin todetermine a more precise optimal puromycin concentration.)F.3. Protocol for Lentiviral Infection and SelectionDay 1:a. Plate target cells and incubate at 37o C, 5% CO2 2:b. Target cells should be approximately 70% confluent. Change tofresh culture media containing 8 µg/mL ene increases the efficiency of viral r, polybrene is toxic to some cell lines. In these celllines, substitute protamine sulfate Add lentiviral particle solution from step E. For a 6 cm targetplate, add between 0.05-1 mL virus (add ≥0.5 mL for a high MOI,and ≤0.1 mL for a low MOI). Scale the amount of virus a ddeddepending on the size of your target (multiplicity of infection) refers to the number ofinfecting viral particles per cell. Addgene recommends thatyou test a range of MOIs to determine the optimal MOI forinfection and gene silencing in your target cell line.d. Incubate cells at 37o C, 5% CO2 3:e. Change to fresh media 24 hours after viral toxicity is observed in your cell line, you maydecrease the infection time to between 4 - 20 hours.

Remove the virus-containing media and replace with freshmedia. Do not add puromycin until at least 24 hours afterinfection to allow for sufficient expression of the puromycinresistance gene.f. To select for infected cells, add puromycin to the media at theconcentration determined in step e recommends that you maintain one uninfectedplate of cells in parallel. This plate will serve as a positivecontrol for the puromycin 4+:g. Change to fresh puromycin-containing media as needed everyfew days.h. Assay infected cells. The following recommendations areguidelines for the number of days you should wait until harvestingyour cells. However, you should optimize the time based on yourcell line and assay:Assay Days post-infectionmRNA knockdown (quantitative PCR) ≥ 3 daysProtein knockdown (western blot) ≥ 4 daysPhenotypic assay ≥ 4 daysBack to TopG. SafetyBL2 safety practices should be followed when preparing and handling lentiviral particles. Personal protective clothing shouldbe worn at all times. Use plastic pipettes in place of glass pipettes or needles. Liquid waste should be decontaminated withat least 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous wasteand autoclaved. Please follow all safety guidelines from your institution and from the CDC and NIH for work in a BL2 you have any questions about what safety practice to follow, please contact your institution's safety obtain the MSDS for this product, visit /doc/ /sitemap and follow theMSDS to TopH. ReferencesH.1. Published A rticlesKhvorova A et. al. 2003. Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209-216. (PubMed)Moffat J et. al. 2006. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content 124:1283-1298. (PubMed)Naldini L et. al. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science272:263-267. (PubMed)

Schwarz DS et. al. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199-208. (PubMed)Stewart SA et. al. 2003. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9(4):493-501. (PubMed)Zufferey R et. al. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15(9):871-5. (PubMed)Zufferey R et. al. 1998. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72(12):9873-80.(PubMed)H.2. Web resourcesAddgene's mammalian RNAi website: /doc/ /rnaitoolsThe RNAi Consortium (TRC):/doc/ /genome_bio/trc/ckground on RNAi mechanism:/doc/ /focus/rnai/animations/animation/ Whitehead siRNASelection Program: /doc/ /bioc/siRNAext/ Mekentosj iRNAi Program:/doc/ /irnai/Back to TopI. AppendixI.1. Sequence of pLKO.1 TRC-Cloning VectorClick here (/doc/ /10878) to see the sequence of pLKO.1 TRC-cloningvector. The vector is 8901 base pairs total, and the stuffer insert is shown in all capital letters.I.2. RecipesLuria Broth Agar (LB agar) + antibioticPer 40 grams of powder from American Bioanalytical catalog #AB01200-02000, LB contains:10g tryptone5g yeast extract10g sodium chloride15g agar> Prepare LB agar solution by dissolving 40g of LB powder in 1Lof distilled water. Autoclave and cool to 55o C. Add 1mL of100mg/mL ampicillin or carbenicillin to obtain a final concentrationof 100 µg/mL antibiotic. Pour plates and store at 4o methrine Bromide (Polybrene)Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268) in 0.9% NaCl. Autoclave to sterilize. Stock solutionis stable at 4o C for up to one year. The powder form of polybrene is stable at 4o C for several ine SulfateStore protamine sulfate (MP Biomedicals catalog #194729) at 4o C. Freely soluble in hot water and slightly soluble in cin

Prepare a 50mg/mL stock solution of puromycin (Sigma-Aldrich catalog #P8833) in distilled water. Sterilize by passingthrough a 0.22 µm filter. Store aliquots at -20o C.I.3. Warranty InformationAddgene is committed to providing scientists with high-quality goods and services. Addgene makes every effort to ensure theaccuracy of its literature, but realizes that typographical or other errors may occur. Addgene makes no warranty of any kindregarding the contents of any literature. Literature are provided to you as a guide and on an "AS IS" "AS AVAILABLE" basiswithout warranty of any kind either expressed or implied, including but not limited to the implied warranties of fitness for aparticular purpose, non-infringement, typicality, safety and distribution of any literature by Addgene is not meant to carry with it, and does not grant any license or rights of access oruse to the materials described in the distribution of materials by Addgene is not meant to carry with it, and does not grant any license, express or implied,under any patent. All transfers of materials from Addgene to any party are governed by Addgene's Terms of Use, Addgene'sTerms of Purchase, and applicable Material Transfer Agreements between the party that deposited the material at Addgeneand the party receiving the to TopHome | Contact | Terms of Use | Privacy Policy | Site Map